Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Intolerance in the DNA
Canada Free Press ^ | 02/08/15 | Dian

Posted on 02/08/2015 10:48:27 AM PST by Sean_Anthony

Dangerous in a world that is so interconnected-where evil spreads in the blink of an eye, the click of a mouse.

“While Christianity fought against its inner evil, removing it from its soul, Islam has not.”

President Barak Obama spoke of intolerance at the National Prayer Breakfast February 5. He fears a backlash toward the more than 1.5 billion Muslims in the world after the release of the video of the burning alive of Jordanian pilot Muath Al-Kasaesbeh by ISIS. And the beheadings of journalists and other Westerners. And the news of Boko Haram and the Yazidis; the mass murder of Christians and other Muslims.

He wanted the world to know that these were anomalies.

“Lest we get on our high horse and think this is unique to some other place, remember that during the Crusades and the Inquisition, people committed terrible deeds in the name of Christ,” Mr. Obama said. “In our home country, slavery and Jim Crow all too often was justified in the name of Christ.”

(Excerpt) Read more at canadafreepress.com ...


TOPICS: Government; History; Politics; Religion
KEYWORDS: dna; intolerance; islam; ramonstock; raymondstock; raystock

1 posted on 02/08/2015 10:48:27 AM PST by Sean_Anthony
[ Post Reply | Private Reply | View Replies]

To: Sean_Anthony

Obama fears a backlash against Muslims, yet he has been at the forefront viciously attacking Christians, conservatives, and anyone else who disagrees with him.


2 posted on 02/08/2015 11:02:35 AM PST by Arm_Bears (Rope. Tree. Politician. Some assembly required.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Sean_Anthony

OBammy fears the LONG OVERDUE backlash..........


3 posted on 02/08/2015 11:08:40 AM PST by Flintlock (Soapbox didn't work; ballot box neither--we're left with the BULLET BOX.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Arm_Bears

I am foursquare against the lie that Mr. Obama told.

It saddened me that he did so.


4 posted on 02/08/2015 11:24:31 AM PST by sauropod (Fat Bottomed Girl: "What difference, at this point, does it make?")
[ Post Reply | Private Reply | To 2 | View Replies]

Defend your Freedom
KEEP FR GOING STRONG

We need your help to keep the lights on.
FR is funded solely by contributions made by
liberty loving people who enjoy and use it.

Every donation counts no matter how big or small.
If you can donate $5, $10, $20, $100 or more,
it would be greatly appreciated.

5 posted on 02/08/2015 11:46:33 AM PST by RedMDer (I don't listen to Liars but when I do I know it's Barack Obama.)
[ Post Reply | Private Reply | View Replies]

To: AdmSmith; AnonymousConservative; Berosus; bigheadfred; Bockscar; cardinal4; ColdOne; ...
While Christianity fought against its inner evil, removing it from its soul, Islam has not.

6 posted on 02/08/2015 1:19:56 PM PST by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary men)
[ Post Reply | Private Reply | View Replies]

To: Sean_Anthony; SunkenCiv; nuconvert
Egypt Under Al-Sisi: An Interview with Raymond Stock

I would say that if al-Sisi truly has established such a doctrine for stability, it would consist of the following:

Anti-Islamism—i.e. a more limited role for Shariah (which is nonetheless still enshrined in the new constitution, yet no longer to be interpreted by the clerics at al-Azhar, but by the government, whose authority and much of its outlook is secular, not religious;

Electoral democracy though with somewhat limited civil liberties, to satisfy both the demand for popular sovereignty and for an end to the endless chaos—strikes and demonstrations (and skyrocketing crime) since the fall of Mubarak in 2011, and to limit the public role of the Islamists, who are at war with Egypt; and

An independent foreign policy—one that still seeks to maintain the traditional alliance with the U.S. and the West, but is not afraid to go elsewhere as needed

Gordon: Why has the US Administration maintained an arm's length relationship with al-Sisi subsequent to the ouster of Morsi?

Stock: It is no doubt due to Obama’s leftist, rather Edward-Saidian worldview, which sees indigenous anti-Western forces such as the Islamists to be the benignly natural and legitimate consequence of American and European policies during the colonial era and the Cold War—for which he has apologized repeatedly. He also has a positive, nostalgic view of Islam, given that he was born of a Muslim father and having apparently been raised as one by his step-father during his early childhood in Indonesia, and seems to project this image onto radical groups like the MB who cleverly pose as moderates. He is thus surrounded by numerous pro-Islamist advisers, as well as those who simply take a naïve view of groups like the MB, Hamas and Hizbollah—and even the Taliban (not a new position, but one now getting attention in the news).

It also means that he denies the common Islamist ideology of all those groups as well as AQ and IS, or even any connection of their beliefs to Islam. This, despite their being made up entirely of Muslims, that they base their ideology and tactics on the Qur’an, Hadith and other key Islamic texts, and that they have a very wide appeal in the global Islamic community. This is even more bizarre if you compare his statements and those of his aides about this question to those of al-Sisi—a Muslim leader of a majority Muslim country—at the seat of Sunni Islam's highest authority, al-Azhar, on New Year's Day. One of them, Obama, is willfully blind; the other, al-Sisi, with devastating clarity, identifies the problem as coming from within the very heart of Islam.

Al-Sisi’s greatest enemy is not the MB, or even IS, but the president of the United States. When the State Department invited key figures from the pro-MB alliance of groups to a major conference in Washington this week, he was signaling his desire (and only Obama sets our foreign policy) to overthrow al-Sisi—just as his invitation to the leaders from the banned MB to sit in the front row of his Cairo speech in 2009 signaled that he wanted to remove Mubarak. So U.S.-dependent international institutions and allies may not be too supportive of al-Sisi.

The only possible silver lining for Egypt is, ironically (given our historic alliance), really a great problem for our country, if one values its role of global leadership since World War II. That is, Obama has done so much to destroy America's standing with the rest of the world that even our closest allies no longer fear to stray, and may yet not follow his wishes regarding al-Sisi. Tragically, on many issues, that may be better for us all until Obama leaves office. For the heading he has set leads directly to hell, a destination that many countries, thanks to in large part to his policies, have already seen (and Syria and Libya have already become)—good intentions (by his lights) notwithstanding.

http://www.meforum.org/5014/egypt-under-al-sisi-an-interview-with-raymond

7 posted on 02/08/2015 2:10:27 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv; nuconvert; gandalftb

An Arab billionaire shares his explosive views on Obama, Israel, ISIS, and why the Arab Spring failed

This is a new angle:

Anonymous Arab Investor: The problem is Israeli politics. As a result of a number of years of rightward movement and of emigration from Russia, the country has moved totally to the right in a political sense. The proportion of people who had deeper intellects and deeper understanding of historical development of the region aren’t there.

http://uk.businessinsider.com/an-interview-with-an-arab-billionaire-2015-2?r=US


8 posted on 02/12/2015 10:20:17 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7 | View Replies]

To: AdmSmith

No, it’s not new. It’s the same BS the Arab bigots have used to justify the killings of Jews since the foundation of the modern state. Before that, it was already the Jews’ fault. This goes all the way back to the Big Old Mo, who mass-murdered the Jews of Arabia (except for the little girls of course).


9 posted on 02/12/2015 1:11:01 PM PST by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary men)
[ Post Reply | Private Reply | To 8 | View Replies]

To: SunkenCiv
Actually, that person is not subscribing to the Mo-stuff. It might explain why Bibi has a complicated relationship with Kremlin.
10 posted on 02/12/2015 2:08:43 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson