Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Here’s why you shouldn’t freak out about that ‘cell phones cause cancer’ study
Yahoo Tech ^ | May 27, 2016 | Kevin Loria, Tech Insider

Posted on 05/29/2016 12:50:08 PM PDT by Swordmaker

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041 next last
To: FlingWingFlyer
Studies will always be with us as long as there are government “grants”.

During my grad school days, I had one very old crusty professor who referred to the Professional Studiers as "damn grant whores".

Judging by my last (and most likely VERY last) visit to my old alum, the crusty old professors are either long gone or so totally outnumbered by those grant whores and other assorted fruits and nuts I don't really think that I'd send a stray cat there to learn how to scratch sand over sh**.

21 posted on 05/29/2016 3:11:14 PM PDT by Unrepentant VN Vet (Smile. It'll drive people nuts trying to figure out what you know or have done.)
[ Post Reply | Private Reply | To 20 | View Replies]

To: AdmSmith; Swordmaker; SunkenCiv

Thank you for the mini-review!

For a while, I worked at a hospital in the clinical studies department. Every single day, I read study proposals and study results that were utter garbage—often, entire studies were based on gathering patient data and then using high-powered statistics to compare every data element to every other data element within the set. And every time there was a correlation between two data elements, at P < 0.05 significance, the study authors would happily write up a paper for publishing. I wanted to scream—this is not science, and has no business being published as such. A statistical correlation means absolutely nothing if there is not a mechanism linking the two correlated elements.

In my field of biochemistry, it is possible to have very high quality results with small sample sizes. But that’s because everything is controlled, save for the one or two variables under study. If you want to show that a gene is repressed by exposure to a chemical, you only need three samples per treatment group for statistical significance. I could run an entire experiment in a 6-well plate—then repeat the experiment twice, and I would have data suitable for publication.

BTW, I like the way you spelled your moniker with codons in your tagline.


22 posted on 05/29/2016 3:11:48 PM PDT by exDemMom (Current visual of the hole the US continues to dig itself into: http://www.usdebtclock.org/)
[ Post Reply | Private Reply | To 19 | View Replies]

To: exDemMom

Thanks.


23 posted on 05/29/2016 3:18:03 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22 | View Replies]

To: PIF

Um, millennials don’t talk on their phones. All they do is text and selfies.


24 posted on 05/29/2016 4:12:56 PM PDT by US_MilitaryRules (The last suit you wear has no pockets!)
[ Post Reply | Private Reply | To 12 | View Replies]

To: US_MilitaryRules

Well, maybe cancer of the fingers and hands! lol


25 posted on 05/29/2016 4:14:11 PM PDT by US_MilitaryRules (The last suit you wear has no pockets!)
[ Post Reply | Private Reply | To 24 | View Replies]

To: US_MilitaryRules

A radio is a radio text or talk all the same radiation.


26 posted on 05/29/2016 4:46:53 PM PDT by PIF (They came for me and mine ... now it is your turn ...)
[ Post Reply | Private Reply | To 24 | View Replies]

To: Swordmaker
It's pretty well known that there is a higher incidence of leukemia near the Vatican radio transmitter towers. The Supreme Court of Italy ordered the Vatican to pay the town of Cesano damages.

My personal opinion is that there may be a higher risk in some people but not necessarily a direct causation in all brain tumors. Cell phones are so ubiquitous and a big part of the economy, there is a vested interest in opposing the results of any study.

Several years ago, phones were even rated as to the power they emitted. It stands to reason that maybe users might want to be more careful just in case.

Most of us are exposed to many other emissions of radio waves due to modern living. Some people have actually located well away from the grid in hopes of avoiding the risk. That is probably a little exteme.

How do I know but what I raise my risk considerably by sitting in front of my big screen imac so long each day?

We have smart meters that broadcast 24/7. They do so in every direction. One is located right outsidee my bedroom window. I was a little uncomfortable about it, but we had no options; I didn't make any waves.

When it came time for the water company to add their smart meter, I became a little concerned. We had to sign off on them. So I tell them I'm not real thrilled to have two emitting waves right outside my bedroom window. So I ask what will happen if I refuse? The answer was under their terms of service, I would be given so much time to comply, then my service would be shut off. IOW we have no viable choice. So I signed. They rigged it in a way I don't fully understand; it runs across the basement and is located on another side of the house where they drive by on a different street to read the meter.

I'm 1/2 mile from a cell phone tower. I don't use my microwave any more but not because of that. I play my radio when I am in bed for long hours. I use to sit close to my short wave radio with a tall antenna, and I ran a wire around the top of the room for better reception.

Then there's radon. I decided what will be will be. We are all at risk for something. The numbers for cancer are now 1 in 3 that in an adult's lifetime they will develop one form of cancer.

They don't really know for sure what causes most cancers. Food additives, smoking, pollutants, Roundup is a culprit now, and the beat goes on.

The bottom line is that maybe people should take care at least enough to turn their phones off at night and keep them away from their bodies where practicable, use ear plugs. It won't stop me from becoming a cell phone user if I decide I want one, and I can't see myself doing much texting even if I got proficient at it because the written word does not replace human conversations, and telephone do not replace face to face conversations.

There will undoubtedly be some societal changes in human interaction due to the way we communicate. The majority will rule.

27 posted on 05/29/2016 4:56:52 PM PDT by Aliska
[ Post Reply | Private Reply | To 1 | View Replies]

To: exDemMom

Thanks.


28 posted on 05/29/2016 5:05:19 PM PDT by Ditter (God Bless Texas!)
[ Post Reply | Private Reply | To 18 | View Replies]

To: Ditter

You are welcome.


29 posted on 05/29/2016 5:27:41 PM PDT by exDemMom (Current visual of the hole the US continues to dig itself into: http://www.usdebtclock.org/)
[ Post Reply | Private Reply | To 28 | View Replies]

To: dfwgator

Sad for HRC and her Blackberry.


30 posted on 05/29/2016 5:31:31 PM PDT by ModelBreaker (')
[ Post Reply | Private Reply | To 2 | View Replies]

To: Aliska
How do I know but what I raise my risk considerably by sitting in front of my big screen imac so long each day?

I know one thing for certain. The amount of energy being emitted by your LED iMac is far less than the amount of energy that was once emitted by your big or little screen CRT monitors we used to sit in front of. . . Or the Fluorescent tube backlit LCD screens before the introduction of LED lit LCD screens. In fact, It is probably so small now that you'd be hard pressed to measure it outside of the visible light range.

I long ago decided that the government should pass a regulation requiring that every maternity hospital delivery room post a sign where every new born can see it when he or she can see it when his or her head pops out reading

CAUTION!
LIVING
MAY BE
HAZARDOUS
TO YOUR
HEALTH!

Give the kid a chance to climb back in right then if he or she doesn't like the possibility that it might be too dangerous to go on out!

31 posted on 05/29/2016 6:40:32 PM PDT by Swordmaker (This tag line is a Microsoft insult free zone... but if the insults to Mac users continue..)
[ Post Reply | Private Reply | To 27 | View Replies]

To: Swordmaker
Yeah, right.

Now I am really f'ed. I can't sign in my google account. I just changed my password and wrote it down.

So I try to change it. Enter my google email address. I have the account all configured to my gmail plus it will dl everything from an isp email account I've had since 1997.

Now no matter what I try, it tells me my browser is not supported and I must dl a new one. I don't want to do that and doubt any of them will be supported by my OS X Safari.

I am so mad I could spit mails. Wish I'd never signed up with google.

32 posted on 05/29/2016 7:01:47 PM PDT by Aliska
[ Post Reply | Private Reply | To 31 | View Replies]

To: PIF
A radio is a radio text or talk all the same radiation.

1) Not even close. SMS is transmitting for a fraction of a second, while a voice call is transmitting for the duration of the call.

B) People whose physiology is within several standard deviations of the norm do not sent text messages with the phone held right next to their skulls.

33 posted on 05/29/2016 10:47:49 PM PDT by ReignOfError
[ Post Reply | Private Reply | To 26 | View Replies]

To: Swordmaker

That’s right.
People shouldn’t worry, they are not canaries.


34 posted on 05/29/2016 10:54:38 PM PDT by conserv8
[ Post Reply | Private Reply | To 1 | View Replies]

To: ReignOfError

Of course all the apps running in the background and GPS features are also just running for fractions of seconds and so on radio is radio and cancer occurs in places other than one’s head - radio is radio and the effects are cumulative.


35 posted on 05/30/2016 2:22:13 AM PDT by PIF (They came for me and mine ... now it is your turn ...)
[ Post Reply | Private Reply | To 33 | View Replies]

To: AdmSmith; freepersup; AnonymousConservative; Berosus; Bockscar; cardinal4; ColdOne; ...

Thanks!


36 posted on 05/30/2016 5:50:51 AM PDT by SunkenCiv (I'll tell you what's wrong with society -- no one drinks from the skulls of their enemies anymore.)
[ Post Reply | Private Reply | To 19 | View Replies]

To: exDemMom

Whoops! And thanks exDemMom!


37 posted on 05/30/2016 5:54:47 AM PDT by SunkenCiv (I'll tell you what's wrong with society -- no one drinks from the skulls of their enemies anymore.)
[ Post Reply | Private Reply | To 36 | View Replies]

To: proxy_user

I do use my phone to talk, but I prefer to use ear buds for that.


38 posted on 05/30/2016 2:15:04 PM PDT by Marie Antoinette (:)
[ Post Reply | Private Reply | To 3 | View Replies]

To: Swordmaker
Here’s why you shouldn’t freak out about that ‘cell phones cause cancer’ study

Because the vast majority of the rats who had the cell phones taped to their heads refused to answer the calls........

39 posted on 05/30/2016 2:17:54 PM PDT by Hot Tabasco (#HillaryForPrison-2016)
[ Post Reply | Private Reply | To 1 | View Replies]

To: exDemMom
It also emits via a small weak transmitter—this is how it finds the nearest cell tower—but I am not sure how often it does that. When you talk on it, of course, it is constantly transmitting.

The registration with the cell tower happens once...when it comes in range. As the phone moves from one segment (there are 6) of a cell tower's area of coverage, the phone re-registers. This happens at far below full power of the phone.

When a call is made of received, the phone briefly transmits at full power which is .8 watts. The cell tower then tells the phone which one of 8 different power levels to use...based on distance from the cell tower.

As a comparison, the old, installed-in-the-vehicle phones with an external antenna used to have full power capability of 3 watts.

40 posted on 05/31/2016 12:29:33 PM PDT by Bloody Sam Roberts (#BlackOlivesMatter)
[ Post Reply | Private Reply | To 18 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson