Free Republic
Browse · Search
News/Activism
Topics · Post Article


6,501 posted on 06/03/2024 5:17:40 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6497 | View Replies ]


To: AdmSmith

VIDEO: DAILY COMMENTARY SUMMATION

03 Jun: Dead in 30 Minutes: Russian Operation GOES TERRIBLY WRONG
War in Ukraine Explained
Reporting from Ukraine
502K subscribers
6-03-2024 11:30 p.m. EST
6:43 Minutes
https://www.youtube.com/watch?v=SI6DZ7fJJoI

⚠️ Watch RFU in 20 languages: https://www.youtube.com/@RFU/channels

I am Ukrainian. My country has been invaded by Russia. In this video, I will tell you what happened on the 831 day of the war.

Day 831: Jun 03

Today, there are a lot of updates from the Bakhmut direction.

The most interesting updates come from the southern flank of Chasiv Yar. Here, the Russians intensified their assaults, reinforced their striking groups, and attempted to conduct an offensive operation across the canal in hopes of cutting off Ukrainian forces in the Kanal district.

After Russian forces consolidated control over the large forest to the east of the canal, the Russian commanders started devising a new plan. The forest provided cover from detection by drones and further FPV drone strikes or artillery strikes, so Russians used it to accumulate large forces for two new assault directions. The forest enables a decent staging ground for a new assault direction to the south of the Kanal district and for assault towards the Novy district to the west of the canal.

The Russian plan here was to cross the canal, since this particular section of it is going underground, providing Russians with stable soil to cross over it. Afterward, the goal of the Russians was to establish positions in another forest to the west of the canal pipes; in order to do this, they would need to establish another foothold. The reason why Russians want to establish a bridgehead here is that it will allow them to covertly accumulate even more forces.

Such a staging ground would enable direct assaults on the Novy residential area to the north of the forest. Ukrainian defenses here are not as strong as in the high-rise area, as this district consists of only small residential houses, which do not give Ukrainians powerful firing positions. Unlike reinforced high-rise buildings, these houses are also easier to destroy by artillery, which explains why Russians would prioritize assaults on the Novy district over the Kanal district.

If Russians managed to take the Novy district in further assaults, they would effectively cut off the main supply road to forces in the Kanal district, forcing the Ukrainians to withdraw from the area. By uppercutting Novy, Russians would overcome the primary Ukrainian defenses of Chasiv Yar in the Kanal district, which could risk a withdrawal to the western side of the water barrier.

Despite establishing a staging ground, Russians encountered a series of major problems.

The staging ground in the forest is isolated from roads, so Russians can only deploy infantry squads to conduct assaults on foot. On top of that, the infantry has to walk on foot all the way to the forest. Such process is time consuming and it delays Russian response period, buying more time for Ukrainian defenders.

Moreover, the above-ground crossing is in the open between the two forests on each side, which would enable the Ukrainians to destroy any troops crossing the canal. With full-time drone observation of the movement of troops and equipment over the canal that isn’t already destroyed, Ukrainians can deploy and prepare troops in the Novy district for a Russian assault heading their way. With Russian infantry being forced to move through a narrow river valley in an open area on their way to execute combat missions, they often ended up being targets of FPV drone strikes.

Furthermore, fighting in the western forest would be troublesome for the Russians, as their vehicles would not be able to move through. If we look at the 3D map, we can see that the area is not only densely covered with trees but also has a very difficult, uneven terrain, allowing us to move only on foot. Such a setting would isolate Russian infantry on the other side without significant firepower. Besides, it would be increasingly difficult for Russian aircraft to determine the locations of their troops and Ukrainians in the dense forest. Any glide bomb strike, therefore, presents a significant risk of friendly fire, making supporting airstrikes very unlikely.

Nonetheless, despite all the reasons that made an assault across the canal inadvisable, Russians decided to proceed with this offensive operation. Ukrainian fighters reported that Russians sent groups of infantry across the canal and noted that they did not last long.

During the assaults, Russians managed to cross the canal, enter the forest, and establish positions close to the outskirts of Novy district.

[Follow along using the transcript.]


6,504 posted on 06/04/2024 2:43:40 AM PDT by UMCRevMom@aol.com (Pray for God 's intervention to stop Putin's invasion of Ukraine 🇺🇸)
[ Post Reply | Private Reply | To 6501 | View Replies ]


6,509 posted on 06/04/2024 8:47:36 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6501 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson