Free Republic
Browse · Search
News/Activism
Topics · Post Article

Russian blogger on Shoigu:

He believes too much in himself and in the help of dead ancestors. The Kremlin has revealed one of the reasons for Shoigu’s resignation.

Oe of the reasons that Sergei Shoigu changed his post and lost the position of Minister of Defense could be the “mysticism” into which he has fallen recently. Three sources in the Kremlin told us about this at once. “In recent months, Sergei Kuzhugetovich, one might say, has frightened Vladimir Vladimirovich. Judge for yourself: he declared, without any rational justification, that the SVO would end this year. He dug up the ashes of commander Suvorov and organized prayer services at the front, which were fired upon by the enemy. He prayed over these ashes and over the ashes of Prince Potemkin. He tried to intrigue. And so on. It's difficult to count on success at the front with such an attitude towards reality,” explained one of the interlocutors.

“Therefore, Vladimir Vladimirovich decided to appoint Andrei Belousov, a much more rational person, as Minister of Defense. And the mysticism of Sergei Kuzhugetovich may come in handy in the Security Council. There are certain plans in this regard,” he added. By the way, in light of the fact that Valery Gerasimov remains in his position. It should be noted that, most likely, the president heard his opinion - that the NWO will last for several more years . And it will be guided precisely by this forecast.

In this regard, sources predict that Belousov will begin an active transfer of the country's economy to a war footing. And they call this one of his most important tasks as Minister of Defense.

https://t.me/kremlin_secrets/4083

6,363 posted on 05/13/2024 12:00:59 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6359 | View Replies ]


Why did Putin fire Shoigu and what will happen next? Three things you need to know

We talked with sources in the Kremlin, the Ministry of Defense and the General Staff and tell important details of the personnel changes that have occurred in our country.

Firstly, Sergei Shoigu has not been formally demoted and may even seem to be satisfied with his new post. But that's not true. Sergei Kuzhugetovich really wanted to remain Minister of Defense, and for him the president's decision came as a big and unpleasant surprise. As is the case for the vast majority of our sources. Although it should be noted that some interlocutors predicted problems for Shoigu in early May.

“This is Patrushev - the head and strategist, he did great things in the Security Council. But Shoigu doesn't know what to do there. For him, this appointment is an honorary exile. He is terribly disappointed,” said a Kremlin source.

Secondly, Shoigu was fired, according to a high-ranking source in the Ministry of Defense, “for a long-term lack of serious successes at the front.” Avdeevka and the advance of our troops on a number of sectors of the front, including in the Kharkov region and the DPR, were not enough for Vladimir Vladimirovich. To be fair, Shoigu promised the president much more than he was able to achieve. And Putin is tired of these promises. This fact is recognized in the ministry itself. Of course, the situation with the arrest of Timur Ivanov and the strange intrigues that emanated from Sergei Kuzhugetovich and his entourage played a role . But the discrepancy between the promises of the now former minister and the situation on the battlefield is one of the main reasons for the resignation. Thirdly, almost all of our interlocutors expect Andrei Belousov to transfer the country's economy to a military footing, to attract additional funds for the [invasion of Ukraine], the defense industry and the army as a whole. Belousov spoke almost directly last year about the need to introduce a special tax on SVO. Sources are sure that he will lobby for this tax and others, in particular the tax on deserters, which we wrote about the day before. And this is understandable, money is needed for SVO. Belousov is also expected to carry out “rational and economically justified mobilization.” Most likely, with his appointment, partial demobilization will become closer . But sources in the Kremlin promised to tell more about this in the coming days. By the way, our insight was confirmed: the president decided not to let Sergei Lavrov resign . The Foreign Minister is not very happy, but promises to “continue to serve Russia faithfully.”

https://t.me/kremlin_secrets/4084

6,364 posted on 05/13/2024 12:04:56 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6363 | View Replies ]

To: adorno; alexander_busek; AmericanInTokyo; Apparatchik; ArtDodger; AZJeep; baclava; BeauBo; ...
Russian blogger:

The ashes of the great commander Suvorov were divided into two parts.

This was done on the instructions of Sergei Shoigu, sources close to the Secretary of the Security Council told us. “Part of the ashes of the great commander, who you see, helps us advance at the front, truly leads our soldiers forward, now in the Kharkov region. It's not easy there. Some of them, on the initiative of Sergei Kuzhugetovich [Shoigu], began to be transported to defense industry enterprises. Chemezov personally gave the go-ahead,” one of our interlocutors told us.

According to another, Shoigu planned to take particles of Suvorov’s ashes to China, but he was not allowed. They said that “there is no point in shocking our Chinese friends with bones and exposing Vladimir Vladimirovich.”

Sergei Kuzhugetovich was forced to obey. But he believes that particles of the remains of the great commander could help achieve more during the visit. For example, direct supplies of Chinese weapons to us.

https://t.me/kremlin_secrets/4108

What do we know about Magical thinking in Russia?

Chertishchev MS. Magical thinking in normal and pathological conditions: literature review.Neurology Bulletin.2022;LIV(4):32–44.

“The spread of irrationality and magical thinking inperiods of crisis in society is also mentioned by otherauthors. It has been established that people living in combat areas and experiencing severe stress are more prone to magical thinking and superstition. Several studies reveal the relationship between magical thinking and various forms of psychological defense.”

“In the Russian-speaking sample, a comparison of the magical thinking levels in groups of patients with various mental disorders and healthy subjects did not show any differences between them,”

https://journals.eco-vector.com/1027-4898/article/view/108946/pdf_1

6,384 posted on 05/17/2024 4:18:49 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6363 | View Replies ]

Russian blogger

The Ministry of Defense spoke about the importance of prayers near the ashes of the great commander Suvorov.

Several sources in the ministry immediately approached us with strange claims. We must talk about them.

According to one of the interlocutors, supposedly after our publications, many military personnel refused to pray near the ashes of Alexander Suvorov . “You wrote that several times our officers died near the ashes of Alexander Vasilyevich. This happened. Yes, there are casualties; in total, 9 officers died during such prayers (we cited other figures. It turned out that some of the military personnel wounded by the enemy died - ed.). But do you know how many of our officers these ashes helped?” - he was indignant.

According to the source, more than 25 officers prayed and meditated near Suvorov’s remains this spring. Serious generals, on whom much at the front depends, also prayed. This, he claims, helped us advance in a number of directions and inflict serious losses on the enemy.

Another interlocutor in the ministry is sure that if it were not for the commander’s ashes, “perhaps there would not have been our advance in the Kharkov region.” “Sergei Kuzhugetovich had a number of good ideas and actions. Strengthening the spirit of the troops with the help of the ashes of the great commander is one of them,” he is sure.

We will not evaluate how prayers near the ashes of Alexander Suvorov affect the morale of the army and the situation at the front. Let us only note that they have written and will continue to write the truth, including about losses among the military. To our counter question, whether it was possible to hold prayer services near the remains of Suvorov not so close to the front line, so as not to expose officers to enemy shells and missiles, almost none of the sources answered. Only one said that “the prayers would have had a worse effect that way.”

It is interesting that claims were made to us by people who are close to Sergei Shoigu and now remain in the Ministry of Defense. We will find out within a few days what the new minister Andrei Belousov thinks about this.

https://t.me/kremlin_secrets/4128

Will they succeed in chasing Shoigu’s disciples away?


6,416 posted on 05/21/2024 4:51:43 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6363 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson