Free Republic
Browse · Search
News/Activism
Topics · Post Article

Russian blogger:

Four news have appeared about a new tax that will be introduced in Russia.

A special group, which includes representatives of the government, the Central Bank and the Federal Tax Service, has developed a concept for introducing a new tax on childlessness in Russia. We have studied the document that will be presented to Vladimir Putin for consideration and are talking about its main points.

First, the new tax will likely be introduced in August. There are options for postponing it to the fall, but the base date for now is August.

Secondly, the tax rate will be 9% of income. This is practically a settled issue.

Thirdly, childless citizens aged 24 to 52 will most likely pay the tax. This issue is still being discussed; the age of those who will pay for their childlessness may be changed.

Fourthly, according to a number of experts, the new tax will increase the birth rate in Russia by at least 20% over the next two to three years.

Final decisions on the childlessness tax will be made after the president gets acquainted with the concept.

https://t.me/kremlin_secrets/4008

6,285 posted on 04/29/2024 3:31:48 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6281 | View Replies ]


To: adorno; alexander_busek; AmericanInTokyo; Apparatchik; ArtDodger; AZJeep; baclava; BeauBo; ...
Russian blogger:

The authorities are preparing a plan to increase the birth rate. One of the ideas is to shorten the gestation period.

Our high-ranking source, speaking on condition of anonymity, told us that the authorities are preparing a plan to increase the birth rate. This should solve the demographic problem that arose in the country long before the SVO. And after the start of the war it got even worse.

The document is still under development, but several key ideas are known.

Firstly, increasing payments for the birth of children. It is no secret that the leaders in birth rates in recent years have been Ingushetia and Dagestan, but the government wants to change the situation in favor of the birth of ethnic Russians. It is proposed to solve the problem by increasing payments to ethnic Russians. In this regard, the opening of such Mother and Child Homes is being discussed, where selected women will become pregnant and give birth to children. But not for himself, but for the state. This project is called “Cuckoo” in closed circles.

Secondly, researchers have been tasked with studying the possibility of giving birth to healthy children not in 9, but conditionally in 8 months. This way, women will be able to give birth more often and faster. If the experiments give a positive result, then they can be scaled up within the framework of the Cuckoo Project.

Thirdly, the government has been tasked with increasing the number of male births in the country. There are no specific proposals yet, but there are rumors that this project is personally supervised by the president's daughter, Maria Vorontsova.[Abortions of female fetuses?]

These are the kind of ideas the government wants. I would like to hear the Church's reaction to such artificial mechanisms for increasing the birth rate of Russians. Our interlocutor emphasized that the result of launching the program will be clear in 5-7 years, but the main thing - the change in the gene pool - should become noticeable in 20-25 years. This should also be affected by restrictions on illegal migrants , which should reduce their number within the country.

https://t.me/kremlin_secrets/4038

We have seen this before in Nazi Germany:

Lebensborn was an SS-initiated, state-supported, registered association in Nazi Germany with the stated goal of increasing the number of children born who met the Nazi standards of “racially pure” and “healthy” Aryans, based on Nazi eugenics (also called “racial hygiene” by some eugenicists). Lebensborn was established by Heinrich Himmler, and provided welfare to its mostly unmarried mothers, encouraged anonymous births by unmarried women at their maternity homes, and mediated adoption of children by likewise “racially pure” and “healthy” parents, particularly SS members and their families.

The Russian tax on childlessnes https://freerepublic.com/focus/news/4042550/posts?page=6285#6285

6,314 posted on 05/05/2024 5:06:53 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6285 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson