Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Russian military convoy has advanced from Ivankiv to outskirts of Kyiv, satellite images show (17 miles long)
CNN ^ | February 28th, 2022 | Paul P. Murphy

Posted on 02/28/2022 8:10:18 PM PST by Mariner

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 1,161-1,1801,181-1,2001,201-1,220 ... 6,561-6,566 next last
To: Widget Jr
Agree, but these pictures are interesting
1,181 posted on 06/01/2022 3:04:01 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1179 | View Replies]

To: AdmSmith

Talking about HIMARS:

President @ZelenskyyUa stated that #Ukraine does not intend to attack #Russian territory with long-range weapons.

https://twitter.com/nexta_tv/status/1531874056647196672


1,182 posted on 06/01/2022 3:14:20 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1180 | View Replies]

To: AdmSmith

Article translated:

RuNews
VLADIMIR PUTIN IS DEAD. THE COUNTRY IS CONTROLLED BY A DOUBLE for Russia only via VPN
Posted by: 29.05.2022 : In the World Author: RuNews

Russian President Vladimir Putin is long dead. The Russian Federation is controlled by the security forces using Putin’s doubles.

How Putin’s face has changed in 15 years. See portraits of Vladimir Vladimirovich to see how his face has changed since 1998. Who will find different faces, write in the comments. For convenience, I have numbered the portraits. Let’s go, the test for the most attentive begins! You can show off your ability to distinguish people from a photo. Not all of them can. Check yourself for attention. Photo resolution 3073 x 2195 pixels.

I’ll try in order. A couple of years ago I read an article in the German Spiegel that in 2006 one of the leading German oncological centers was consulted by the Moscow Central Clinical Hospital regarding a biopsy of an anonymous patient. The Germans conducted an analysis, established the form of cancer and gave the patient a maximum of 6 months. They thanked him from Russia, but they refused treatment, moreover, after a while the German doctors were informed that the patient was completely healthy.

I think there is no need to explain that in any self-respecting state there are “genetic portraits” of the most significant people (hairs, skin particles and other biomaterial are used for this, which a living person inevitably leaves, for example, during foreign visits). in the West DNA-portrait” of Putin , so the Germans figured out who they were talking about even without the Kremlin’s instructions. And at the latest by mid-2007, the patient was supposed to die.

Well, now let’s see how events develop further. Since 2007, Lyudmila Putina - she no longer participates in receptions, foreign trips. No clear reasons were given. In 2007, the surprising idea of ​​Putin’s refusal of a third term in favor of Medvedev appears. Allegedly, all this is due to the Constitution, which prohibits the third term.

But, firstly, they put it on the Constitution (for example, it prescribes to elect governors, and they have been appointed since 2004), and secondly, the Constitution does not write three terms in a row, but three terms in general, i.e. The current term of “Putin” is generally unconstitutional.

“Putin” goes into the shadows, becoming prime minister, sitting in the country without getting out, leaving only for the CIS and regions of Russia. Rapid and inexplicable changes are taking place in the appearance of “Putin”, which at first are not commented on in any way, but when it becomes impossible not to notice them, a version of unsuccessful plastic surgery and Botox is thrown up. “Putin” ceases to recognize old acquaintances (for example, colleagues from the KGB), no longer understands German without translation, ties up with sports (for example, skiing), often speaks out of place, gets confused in the facts of his own biography, and at the same time happens in different places. In addition, there are several different “Putins”, quite different from each other.

From all this, I conclude that the real Putin V.V. most likely he either died or was incapacitated over the past 5-6 years. Initially, a soft transition of power to Medvedev was planned, but he showed his absolute incompetence, so he had to reincarnate the image of Pu, since modern technologies allow this. For example, in the 90s, TV showed video reports of EBN’s trips and meetings while he was on a drip in the hospital for months.

This explains the strangeness with divorce. Indeed, all dogs are traditionally hanged on former leaders in Russia, and in order to protect the spouse from future troubles, she was “divorced” ahead of time - now she and the children have nothing to do with “Putin”.

Mr. Putin has been in the public eye since 1999, although the lesser public has seen him before, when he worked in Mr. Sobchak’s administration. Therefore, in general, the period of video coverage of the GDP (that is, the availability of photographic documents for this person) covers almost 20 years. Having on hand photographs of a person for 20 years, it is not very difficult to detect a substitution. On the site, with photographs, four completely different people are depicted.

They have a different skull shape (the width of the eye sockets, the shape of the chin, the shape of the zygomatic bones), they have a different volume of soft tissues and cartilage of the face (wings of the nose, lips, cheeks), they have different hair boundaries (scalp and eyebrows), they have different eye color, they have a different look expression. What can I say just about photos, when on the official websites of the government, there are photos of clearly different people: A good thing is an Internet search engine. By request “putin photo” you can get 100,500 photos.

Here is Putin V.V. with Sobchak. But comparing Putin with Sobchak is not interesting. It is much more interesting to compare Putin with Putin. And if you level the portraits in height and assemble them in pairs for convenience, then it’s a most entertaining sight: In the last photo on the left is V.V. Putin takes the presidential oath in 2000, on the right - now shed a tear from the results of the vote in 2012. And you: “Russia without Putin”, “ Russia without Putin.

Yes, looking at such paired photos, the first thought is “The king is not real!”. You can argue indefinitely about the shape of the ears, think about the properties of Botox and the effects of hormone therapy. But something tells me that Pelevin in his “Generation P” was not so wrong and the media are able to inspire us with anything; there is a president, there is no president, what the hell is the difference - the main thing is the picture. Moreover, just like Pelevin, the question of who gives the order to the media is open. The members of his family are long gone. And the pictures are pretty cool, yes.

Photos and videos provided by the official Kremlin after 2000 show at least four people, each of whom resembles Vladimir Putin in one way or another. As a maximum (and it is most likely) there are generally six completely different people who are passed off as Putin.
Russia is being destroyed by Putin’s doubles


1,183 posted on 06/01/2022 3:30:51 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 1176 | View Replies]

To: AdmSmith
667 killed Russian officers so far. Minimum confirmed losses as of February 2022, based on death or burial notices from the Russian side.

https://twitter.com/KilledInUkraine/status/1531910997828685824

1,184 posted on 06/01/2022 3:39:31 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1178 | View Replies]

To: PIF

Thanks


1,185 posted on 06/01/2022 3:39:45 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1183 | View Replies]

To: AdmSmith

I think it’s more likely that a double may have been photographed once or twice. But I think we’re dealing with the same Putin. (tho his mental faculties may have changed)


1,186 posted on 06/01/2022 4:29:12 AM PDT by nuconvert ( Warning: Accused of being a radical militarist. Approach with caution.)
[ Post Reply | Private Reply | To 1176 | View Replies]

To: nuconvert

Yes.


1,187 posted on 06/01/2022 5:48:01 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1186 | View Replies]

To: nuconvert
Schemes obtained exclusive audio recordings from a Ukrainian intelligence agency in which Russian colonels discuss the leaders of the so-called Russian special operation in Ukraine. “Shoigu is completely incompetent”, “Putin is a f**king c*nt”, “Dvornikov is a f**king legend on being an imbecile”, and “they have created a whole host of sycophantic motherf**kers”. Also in their conversation, they are trying to justify the easily debunked war crimes of the Russian army with theses of Russian propaganda. Journalists obtained data that allowed them to identify the interlocutors and confirm the authenticity of the recordings.

One is a Russian colonel who commanded missile divisions during the 2015 shelling of Mariupol,when 30 civilians were killed. The other is a military doctor, originally from Vinnitsa region, and has many relatives in Ukraine. During the conversation, he also called for the shelling of civilian targets and civilians: “Waste these f**king bombs, f**k it, there's f**king loads of them, throw them, for f**k’s sake. Even if they hit the wrong f**king place, let them be f**king scared, shoot the f**king train stations, shoot the f**king railways, for f**k’s sake.”

https://www.youtube.com/watch?v=MPcXVTC012U

1,188 posted on 06/01/2022 6:13:19 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1186 | View Replies]

To: AdmSmith

SJWs always *PROJECT*.

Therefore should one conclude that Biden has been replaced?


1,189 posted on 06/01/2022 6:38:32 AM PDT by grey_whiskers (The opinions are solely those of the author and are subject to change with out notice.)
[ Post Reply | Private Reply | To 1176 | View Replies]

To: AdmSmith
The amount of Ukrainian territory occupied by Russia, equivalent to other European countries. This is what appeasers would gift to Putin, along with all the human beings who live there.

https://twitter.com/Kasparov63/status/1532048112835076096

1,190 posted on 06/01/2022 10:54:07 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1188 | View Replies]

To: AdmSmith

1,191 posted on 06/01/2022 12:30:18 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1190 | View Replies]

To: AdmSmith

1,192 posted on 06/02/2022 12:27:26 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1175 | View Replies]

To: AdmSmith

Interview With American Volunteer, James Vasques, Fighting In Ukraine

https://www.youtube.com/watch?v=QNXkc07ihiY


1,193 posted on 06/02/2022 1:17:26 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1188 | View Replies]

To: AdmSmith

Last night, President Zelensky said that over 200,000 Ukrainian children are among the million+ Ukrainians who have been forcibly deported to Russia in the past few months.

Part of the campaign to erase Ukrainian identity.

It is Russia that has changed the borders of the war

https://twitter.com/MollyMcKew/status/1532286129810055169


1,194 posted on 06/02/2022 5:20:05 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1193 | View Replies]

To: AdmSmith

1,195 posted on 06/02/2022 5:21:20 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1178 | View Replies]

To: AdmSmith

Video of a Ukrainian soldier using a Switchblade 300 loitering munition.

https://twitter.com/RALee85/status/1532264015333838848

Playing some Wagner while preparing to blow up some guys from Wagner.
xx

AeroVironment’s Switchblade® 300 Loitering Missile
https://www.youtube.com/watch?v=7sjIhm0Ph8I


1,196 posted on 06/02/2022 5:32:00 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1194 | View Replies]

To: AdmSmith
Video from pro-Russian Telegram: DNR 113th regiment complains to Putin they've been fighting on the front in Kherson region “in hunger and cold;” no meds. They say they're thrown to the slaughter without proper weapons, and ask to return to Donetsk, to stop mobilization there.
https://twitter.com/ChristopherJM/status/1532266831393828864

Look at their gear. They say that some members of their company are not eligible for military draft because of chronic health conditions or family situation, yet they were forced into service. Now they are asking Putin to restore justice.

The belief in the Tsar is like Russia many years ago.

In other words, if only the Tsar knew of the injustices that his underlings were committing over the people, he would immediately respond and correct them.

https://www.thecollector.com/letter-writing-to-tsar-russian-tradition/

1,197 posted on 06/02/2022 5:59:19 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1196 | View Replies]

To: AdmSmith

02JUN2022 SVR General (Генерал СВР):
We have repeatedly talked about how Russian President Vladimir Putin approaches decision-making. Almost always, he gives the order to prepare several options for solving one issue for different people, while the solutions may differ radically from each other. In most cases, after listening to or reading a report with some kind of proposal, Putin, if you consider this proposal sensible, agrees to prepare for its implementation, while not giving final consent to the implementation of this decision. So, for example, today several groups are preparing different scenarios for the occupied territories of Ukraine. Kiriyenko is preparing his plan to join the occupied Ukraine and the Republic of Belarus to Russia, or rather, to reunite the “fraternal republics” into a union state, we talked about this recently. Turchak, Khusnullin and Slutsky are in the group for preparing the accession to Russia of the same occupied territories, including the LDNR, through a “referendum” in the shortest possible time, and they are also still in the process of developing the concept. And the Ministry of Foreign Affairs, according to its plans, which the president also approved for preparation, is preparing for the opening of “embassies” of the LDNR, which supposedly will soon become part of Russia. The confusion in the official, diametrically different positions of all groups should not confuse or mislead anyone, Putin has a clear understanding that these territories should be part of Russia, and he will approve the method when he considers it necessary, or rather necessary.

With regard to the military operation, Putin has a different approach. Here he prefers to change figures that do not meet his expectations, or rather, remove those who took responsibility for completing tasks and failed to complete the deadlines. So, today, Valery Gerasimov, Alexander Dvornikov and a number of other generals have been removed from decision-making and command of a military operation, not to mention Defense Minister Sergei Shoigu. At the same time, nominally most of these people are at their posts, including the commander of the Black Sea Fleet, Igor Osipov, who was wounded on the cruiser Moskva and fell into disgrace.

Putin is the sole beneficiary of the system of power in Russia, and the “managed chaos” he brings into this system is also an integral part of it. Putin’s departure will leave chaos in the system, which no one will control, and the END will come to the system. Soon. Save yourself, the system cannot be saved.

https://t.me/generalsvr/889


1,198 posted on 06/02/2022 9:18:39 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1177 | View Replies]

To: AdmSmith
The people of Lithuania have honorably raised funds to buy a Bayraktar TB2 for Ukraine.

Upon learning this, Baykar will gift a Bayraktar TB2 to Lithuania free of charge and asks those funds go to Ukraine for humanitarian aid.

https://twitter.com/BaykarTech/status/1532318260833705984

Çok teşekkürler

1,199 posted on 06/02/2022 10:32:28 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1149 | View Replies]

To: AdmSmith

1,200 posted on 06/02/2022 11:44:02 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1192 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 1,161-1,1801,181-1,2001,201-1,220 ... 6,561-6,566 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson