Free Republic
Browse · Search
News/Activism
Topics · Post Article

To: Pelham

I kind of got sucked into the periphery of studying viruses as two of my children became microbiologists doing genetic engineering and pharmacology
work with viruses.

Both worked in spacesuits, as much to protect contamination of the target as themselves.

The subject fascinates me so much that about two months ago as I was getting lots of immunizations for remote foreign travel, I began reading about the RNA viruses vs DNA viruses and all the different shapes and sizes using the Baltimore classifications.

My kids think I’m nuts, but when I feel a virus in a person, it is a separate swarm of consciousness that flows similar to a swarm of gnats in and around the person. It puzzles the heck out of me.

I have no idea where I’m going with it, if anywhere, but my level of scientific curiosity is through the roof. I know the solution is in the DNA transcription/replication process in an epigenetic way similar to methylation.

It beats crossword puzzles!


33 posted on 01/25/2020 2:10:38 PM PST by tired&retired (Blessings)
[ Post Reply | Private Reply | To 26 | View Replies ]


To: tired&retired

Try this http://www.virology.ws/course/ and the videos
https://www.youtube.com/watch?v=svlKm4S1M3Y


35 posted on 01/25/2020 2:15:48 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 33 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson