Free Republic
Browse · Search
News/Activism
Topics · Post Article

To: nuconvert

A complete protocol for whole-genome sequencing of virus from clinical samples: Application to coronavirus OC43

This innovative approach allows to rapidly (1–2 days) obtain a consensus sequence directly from clinical samples loaded with as few as 50 genome copies per reaction. This method is of great interest during outbreak and can also be used as an inexpensive and convenient method in the lab.

https://www.sciencedirect.com/science/article/pii/S0042682219300728


21 posted on 01/25/2020 10:00:00 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 17 | View Replies ]


To: AdmSmith

Here is a live map of the spreading of the infection.

https://3g.dxy.cn/newh5/view/pneumonia_peopleapp?from=timeline&isappinstalled=0

check if often for updates!


22 posted on 01/25/2020 10:26:37 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 21 | View Replies ]

To: AdmSmith

Thanks for posting that


24 posted on 01/25/2020 11:07:31 AM PST by nuconvert ( Warning: Accused of being a radical militarist. Approach with caution.)
[ Post Reply | Private Reply | To 21 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson