Free Republic
Browse · Search
News/Activism
Topics · Post Article

To: AdmSmith

The Kurds are getting a little out of hand here.

They also claim to have had a deep mole, onsite when the raid began, etc.

We’ve had ABB’s DNA since he was our prisoner at Abu Ghraib and Camp Bucca.

If DNA was available to prove his recent location, we would have hit him immediately.

We found him by watching for known associates and watching at previous known safe houses that had been divulged by one of his wives this last summer.


157 posted on 10/28/2019 2:28:14 PM PDT by gandalftb
[ Post Reply | Private Reply | To 154 | View Replies ]


To: gandalftb

Kurdish sources provided key info that ABB was preparing to move to Jarabulus (a Turkish held area) and that speeded up the decision to strike in Idlib, they have now taken down Daesh targets in Afrin and Jarabulus.

some of this is described here https://twitter.com/Mekut_Mallet/status/1188967071255793664

https://twitter.com/matthew_petti/status/1188948316710735872


158 posted on 10/28/2019 5:18:00 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 157 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson