Free Republic
Browse · Search
News/Activism
Topics · Post Article

To: AdmSmith

According to Ferhat Abdi Sahin, better known by his noms de guerre Mazloum Abdi and Mazloum Kobane or Mazlum Kobani, previously Sahin Cilo, a Syrian Kurdish military leader, serving as the commander-in-chief of the Syrian Democratic Forces.

2h ago:

Coordination and joint action in pursuing and targeting the leaders of the terrorist organization Daesh continue at a high rate and similar operations will occur soon.
https://twitter.com/MazloumAbdi/status/1188444120089538561


134 posted on 10/27/2019 8:44:15 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 133 | View Replies ]


To: AdmSmith

“Coordination and joint action in pursuing and targeting the leaders of the terrorist organization Daesh continue at a high rate and similar operations will occur soon.”

Sounds good to me. But he shouldn’t advertise it on Twitter.


136 posted on 10/27/2019 9:27:37 AM PDT by nuconvert ( Khomeini promised change too // Hail, Chairman O)
[ Post Reply | Private Reply | To 134 | View Replies ]

To: nuconvert; gandalftb; BeauBo

A good summary:

The Kurdish-led Syrian Democratic Forces (SDF) spent five months working with the U.S. government to gather intelligence on Baghdadi’s whereabouts, according to Kurdish and U.S. officials. Gen. Mazloum Abdi, SDF commander, was the only foreigner to know about the target, he told Foreign Policy through a translator. His account was confirmed independently by the senior U.S. official.

The operation was delayed for a full month by Turkey’s military activity at the border and the subsequent incursion into northeastern Syria, Mazloum said. Ankara moved into Syria days after Trump withdrew U.S. forces from the border in early October, move was widely seen as essentially green-lighting the Turkish operation.

“Mazloum built a sophisticated network of informers in Northwest Syria, a lot of his intelligence helped even stopping terrorist attacks in the west,” said Ahed Alhendi, a Syrian analyst close to the Syrian Democratic Council (SDC), the SDF’s political arm.

read the full article:
https://foreignpolicy.com/2019/10/27/isis-islamic-state-leader-baghdadi-killed/


137 posted on 10/27/2019 9:30:44 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 134 | View Replies ]

To: gandalftb; nuconvert

Gen. Mazlum tells @NBCNews Kurdish intelligence helped track down ISIS leader Abu Bakr al-Baghdadi by stealing his used underwear and a sample of his hair to test for DNA, and that US intelligence confirmed a match months ago.

https://twitter.com/RichardEngel/status/1188867567349391361

Kurdish Intelligence doing the dirty work.


154 posted on 10/28/2019 12:01:01 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 134 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson