Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

KUWAITI ANNAHAR NEWS: ISIS leader Abu Bakr al-Baghdadi IS DEAD! — KILLED IN US RAID
Gateway Pundit ^ | October 26, 2019 | Jim Hoft

Posted on 10/26/2019 8:15:30 PM PDT by ALASKA

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 81-100101-120121-140141-158 last
To: AdmSmith

Solid reporting there.

We did not have an exact location until 3 weeks ago.


141 posted on 10/27/2019 10:30:52 AM PDT by gandalftb
[ Post Reply | Private Reply | To 137 | View Replies]

To: Justa; Lurkinanloomin

“Libya was then used as a staging area to arm jihadists in Syria.”

CORRECT

Sounds to me like Justa has been duped about Benghazi by Susan Rice.

Or by Ben Rhodes.


142 posted on 10/27/2019 10:40:29 AM PDT by MarvinStinson
[ Post Reply | Private Reply | To 131 | View Replies]

To: gandalftb
This is from 09AUG2019
Daesh leader Abu Bakr Al-Baghdadi has nominated Abdullah Qardash as his successor, Anadolu Agency quoted Daesh’s Amaq News Agency as saying “to take care of the Muslims affairs.” The successor Qardash was detained in the Bucca prison in Basra Governorate and had previously worked for Al-Qaeda. Qardash is a graduate of the College of Imam Al-Adham Abu Hanifa Al-Nu’manin Mosul. The security expert pointed out that Qardash was close to the leader Abu Alaa Al-Afri, the second-in-command of Daesh, who was killed in 2016.

Amaq said, that Al-Baghdadi nominated the Turkmen Abdullah Qardash, from the district of Tal Afar west of Mosul,

Al-Basri also said that Al-Baghdadi suffers from paralysis of his limbs due to missile shrapnel injuries in the spinal column during an operation by the Falcons Intelligence Cell in coordination with the air force. This occurred during a meeting between Al-Baghdadi in Hajin, southeast of the Syrian governorate of Deir ez-Zor, before its liberation in 2018.

https://www.middleeastmonitor.com/20190809-al-baghdadi-nominates-iraqi-abdullah-qardash-as-his-successor-to-lead-daesh/

In other words, ABB is just a symbolic figure not the head of Daesh, perhaps Erdogan dropped ABB under the bus?

143 posted on 10/27/2019 10:56:20 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 141 | View Replies]

To: AdmSmith

Abu Bakr Al-Baghdadi has been decentralizing for some time. He knew his days were numbered. However, he had a number of subordinates that were much closer to him in location.

Remember, they rarely used cell phones so word of mouth means being local.

It’s the locals that we are hot on the trail of. We just degraded his ISIS spokesman, Abu al-Hassan al-Muhajir, about 2 hours ago driving out of Ain al-Baydah, near Jarablus, heading for Turkey.

Hopefully we can degrade more of his command before the site intel gets stale.


144 posted on 10/27/2019 11:09:13 AM PDT by gandalftb
[ Post Reply | Private Reply | To 143 | View Replies]

To: AdmSmith

https://twitter.com/RojavaNetwork/status/1188500701745500165


145 posted on 10/27/2019 11:09:45 AM PDT by gandalftb
[ Post Reply | Private Reply | To 143 | View Replies]

To: gandalftb

Yes, Mazloum Abdi said something about addition operations 5 h ago see https://www.freerepublic.com/focus/news/3789345/posts?page=134#134


146 posted on 10/27/2019 11:13:29 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 145 | View Replies]

To: AdmSmith

Here is the likely raid location:

https://www.google.com/maps/place/36%C2%B009’58.5%22N+36%C2%B037’39.3%22E/@36.16625,36.6270361,226m/data=!3m2!1e3!4b1!4m6!3m5!1s0x0:0x0!7e2!8m2!3d36.1662573!4d36.6275703

The compound was built last spring. Zoom out and see how close the Turkish border is. This area is controlled by the Turks, there is a Turkish Post office in town. Hmmm.


147 posted on 10/27/2019 11:32:09 AM PDT by gandalftb
[ Post Reply | Private Reply | To 146 | View Replies]

To: gandalftb

Unconfirmed: Here are the other ISIS leaders possibly killed during the raid:

Abu Said al-Iraqi

Ghazwan al-Rawi, bodyguard to Abu al-Yaman, head of ISIS security in Syria.

Abu Mohamed al-Halabi, a commander of Horas al-Din, a local militia.


148 posted on 10/27/2019 11:42:46 AM PDT by gandalftb
[ Post Reply | Private Reply | To 147 | View Replies]

To: Lurkinanloomin

“Yeah, sure we never had anything to do with jihadists.”

So hiring some unvetted guards who were affiliated with al qaeda = actively supporting Jihadists?

Do you know what “unvetted” means? Of course you do. It means the State Dept. contracted with a company that lied about the qualifications and identities of its employees. And this equals official US support of Jihadists?

Your only intention is to blame America first so facts be damned. You thread any fact you can find in order to Blame-America-First.

RT Troll.


149 posted on 10/27/2019 12:46:31 PM PDT by Justa (If where you came from is so great then why aren't Floridians moving there?)
[ Post Reply | Private Reply | To 139 | View Replies]

To: Justa

Neocon apologist


150 posted on 10/27/2019 12:52:35 PM PDT by Lurkinanloomin (Natural Born Citizens Are Born Here of Citizen Parents_Know Islam, No Peace-No Islam, Know Peace)
[ Post Reply | Private Reply | To 149 | View Replies]

To: AdmSmith

Thanks for that post


151 posted on 10/27/2019 2:12:26 PM PDT by nuconvert ( Khomeini promised change too // Hail, Chairman O)
[ Post Reply | Private Reply | To 137 | View Replies]

To: AdmSmith

” Al-Baghdadi suffers from paralysis of his limbs “

hmm...was he wheeled into the tunnel where he died?


152 posted on 10/27/2019 2:15:45 PM PDT by nuconvert ( Khomeini promised change too // Hail, Chairman O)
[ Post Reply | Private Reply | To 143 | View Replies]

To: nuconvert; gandalftb

more from the SDF commander:
International community must investigate seriously about why all high claass #ISIS members were hiding in the western #Syria which is under #Turkey’s control.

https://twitter.com/cmoc_sdf/status/1188549981617164288

another informative article

https://www.nytimes.com/2019/10/27/world/middleeast/al-baghdadi-dead.html


153 posted on 10/27/2019 3:54:47 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 152 | View Replies]

To: gandalftb; nuconvert

Gen. Mazlum tells @NBCNews Kurdish intelligence helped track down ISIS leader Abu Bakr al-Baghdadi by stealing his used underwear and a sample of his hair to test for DNA, and that US intelligence confirmed a match months ago.

https://twitter.com/RichardEngel/status/1188867567349391361

Kurdish Intelligence doing the dirty work.


154 posted on 10/28/2019 12:01:01 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 134 | View Replies]

To: AdmSmith

“Kurdish Intelligence doing the dirty work.”

eewww

Ya got that right!


155 posted on 10/28/2019 12:02:48 PM PDT by nuconvert ( Khomeini promised change too // Hail, Chairman O)
[ Post Reply | Private Reply | To 154 | View Replies]

Correction: it was used underwear + blood (not hair)


156 posted on 10/28/2019 12:03:17 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 154 | View Replies]

To: AdmSmith

The Kurds are getting a little out of hand here.

They also claim to have had a deep mole, onsite when the raid began, etc.

We’ve had ABB’s DNA since he was our prisoner at Abu Ghraib and Camp Bucca.

If DNA was available to prove his recent location, we would have hit him immediately.

We found him by watching for known associates and watching at previous known safe houses that had been divulged by one of his wives this last summer.


157 posted on 10/28/2019 2:28:14 PM PDT by gandalftb
[ Post Reply | Private Reply | To 154 | View Replies]

To: gandalftb

Kurdish sources provided key info that ABB was preparing to move to Jarabulus (a Turkish held area) and that speeded up the decision to strike in Idlib, they have now taken down Daesh targets in Afrin and Jarabulus.

some of this is described here https://twitter.com/Mekut_Mallet/status/1188967071255793664

https://twitter.com/matthew_petti/status/1188948316710735872


158 posted on 10/28/2019 5:18:00 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 157 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 81-100101-120121-140141-158 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson