Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

A Massive Lake of Molten Carbon The Size of Mexico is Discovered Under The US
GeologyIn ^ | 30 Apr 2017

Posted on 04/30/2017 8:38:09 PM PDT by shove_it

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 61-8081-100101-120121-138 last
To: TruthWillWin

“Does this mean that SUVs can be found in the earths mantle?”

Maybe some Chevrolet Avalanches. What idiot at General Motors picked that name anyway?


121 posted on 05/01/2017 10:34:36 AM PDT by RipSawyer (Racism is racism regardless of the race of the racist)
[ Post Reply | Private Reply | To 6 | View Replies]

To: shove_it

Uhhh, they mean old discovery? We’ve known about that super volcano for years. How about we pop it and see if it solves the global warming hysteria?


122 posted on 05/01/2017 11:12:28 AM PDT by VaeVictis (~Woe to the Conquered~)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Vince Ferrer
I would guess that molten carbon , if released to the surface and cooled, would just solidify to graphite.

Think of it as diamonds in the rough...

123 posted on 05/01/2017 11:34:33 AM PDT by GGpaX4DumpedTea ((I am a Tea Party descendant...steeped in the Constitutional Republic given to us by the Founders))
[ Post Reply | Private Reply | To 13 | View Replies]

To: blackpacific
I agree with you, perhaps I took the wrong approach on my post.
124 posted on 05/01/2017 8:00:22 PM PDT by Fungi (No tagline.)
[ Post Reply | Private Reply | To 66 | View Replies]

To: Vince Ferrer

I was just reading somewhere that the “Ozone Hole” we were supposed to worry about opens up at the Poles during their respective winter months due to the fact that the Sun does not shine there. The Sun, which is supposed to burn us all alive through the Ozone Hole actually creates Ozone when it shines on the atmosphere, so that there will never be an “Ozone Hole” between us and the Sun. There will be an “Ozone Blanket” as needed, just as God intended.


125 posted on 05/01/2017 10:16:37 PM PDT by blackpacific
[ Post Reply | Private Reply | To 15 | View Replies]

To: Fungi
What does this mean for Carbon-14 dating? Doesn't C-14 dating rely upon the exposure and constant decay in the presence of environmental factors? What happens when a cataclysmic eruption takes place, like the Long Valley Caldera or Yellowstone? Will the newly liberated carbon totally skew the C-14 timeline that is so revered in certain scientism circles?
126 posted on 05/01/2017 10:22:25 PM PDT by blackpacific
[ Post Reply | Private Reply | To 124 | View Replies]

To: Paul R.; reg45; ApplegateRanch

Badly written article.

According to this https://www.sciencedaily.com/releases/2017/02/170213090756.htm it is “Under the western US is a huge underground partially-molten reservoir of liquid carbonate. It is a result of one of the tectonic plates of the Pacific Ocean forced underneath the western USA, undergoing partial melting thanks to gasses like CO2 and H2O contained in the minerals dissolved in it.”


127 posted on 05/01/2017 10:55:00 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 88 | View Replies]

To: shove_it

Did they have to say “the size of Mexico”? Now the illegals will claim all that land too.


128 posted on 05/01/2017 11:00:02 PM PDT by Yaelle
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mrs. Don-o

KT, sorry. Dyslexic typist.


129 posted on 05/02/2017 1:10:40 AM PDT by patton
[ Post Reply | Private Reply | To 73 | View Replies]

To: shove_it

The sky is falling! The sky is falling! Quick, send us more money, and we will prop it up!


130 posted on 05/02/2017 1:17:35 AM PDT by Kalamata
[ Post Reply | Private Reply | To 1 | View Replies]

To: patton

OK, thanks. I was confused there. From the context, I should have known you meant the K-T boundary.<p

Molter carbon discovery is sure interesting, altogether.


131 posted on 05/02/2017 5:45:21 AM PDT by Mrs. Don-o (Enquiring minds want to know.)
[ Post Reply | Private Reply | To 129 | View Replies]

To: AdmSmith; AnonymousConservative; Berosus; Bockscar; cardinal4; ColdOne; Convert from ECUSA; ...

Oh look — more carbon-causes-global-warming b******* from Europe.


132 posted on 09/16/2017 10:50:01 PM PDT by SunkenCiv (www.tapatalk.com/groups/godsgravesglyphs/, forum.darwincentral.org, www.gopbriefingroom.com)
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv

We should drill down and tap that resource.

We could corner the global market on Bucky Balls and carbon nano tubes.


133 posted on 09/17/2017 1:10:14 AM PDT by Grimmy (equivocation is but the first step along the road to capitulation)
[ Post Reply | Private Reply | To 132 | View Replies]

To: Daniel Ramsey

The molten carbon from down under would burst into flame upon exposure to the atmosphere, giving Algore a heart attack.


134 posted on 09/17/2017 1:34:42 AM PDT by cynwoody
[ Post Reply | Private Reply | To 84 | View Replies]

To: Grimmy

I’d agree, but note some of the other comments in the thread about what’s down there. Also, even the nitwit article author noted that we can’t drill down that far anyway, IOW, there’s not one little bit of danger of our opening a hole we can’t close, for example. :^)


135 posted on 09/17/2017 1:59:06 AM PDT by SunkenCiv (www.tapatalk.com/groups/godsgravesglyphs/, forum.darwincentral.org, www.gopbriefingroom.com)
[ Post Reply | Private Reply | To 133 | View Replies]

Looks like a dancing GSD to me...


136 posted on 09/17/2017 2:01:11 AM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 1 | View Replies]

"scientists now believe"

137 posted on 09/17/2017 2:03:10 AM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv

Worked for British Petroleum.


138 posted on 09/17/2017 2:13:06 AM PDT by Grimmy (equivocation is but the first step along the road to capitulation)
[ Post Reply | Private Reply | To 135 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 61-8081-100101-120121-138 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson