Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Bomb that took out Russian Metrojet was in plane's main cabin: report
Daily News ^ | November 18, 201

Posted on 11/18/2015 8:32:23 AM PST by McGruff

A bomb that downed a Russian plane in Egypt last month had been placed in the aircraft's main cabin not in the cargo compartment as reported earlier, the daily Kommersant said on Wednesday citing an unnamed source.

The newspaper, citing a source close to the investigation of the crash, said the epicenter of the explosion appeared to have been at the rear of the cabin near the tail section.

"According to a preliminary version, the bomb could have been laid under the passenger seat by the window. Its operation has led to the destruction of the frame and depressurization of the cabin, which had an explosive character," the newspaper said.


TOPICS: Egypt; Extended News; Foreign Affairs; News/Current Events; Russia; United Kingdom
KEYWORDS: egypt; eritrea; metrojet; mi5; scotlandyard; sinai; unitedkingdom; yemen
Navigation: use the links below to view more comments.
first previous 1-2021-4041-46 next last
To: McGruff

ISIS claim they bombed Russian plane using this Schweppes pineapple drinks can

Islamic State claims this picture reveals the bomb which brought down the Russian jetliner killing 224 people – disguised as a drinks can.

The image appeared in the latest edition of the extremists’ magazine Dabiq.

The edition celebrates the recent Paris attacks and is entitled ‘Just Terror’.

The magazine also claims to have images of passports belonging to victims who perished after the Metrojet flight exploded over Sinai.

It disintegrated in mid-air 23 minutes after taking off from popular tourist resort Sharm El-Sheikh in Egypt for St Petersburg on October 31.

http://www.mirror.co.uk/news/uk-news/russian-plane-crash-isis-release-6855639


21 posted on 11/18/2015 9:03:59 AM PST by wtd
[ Post Reply | Private Reply | To 1 | View Replies]

To: Cowgirl of Justice

http://heavy.com/news/2015/10/isis-islamic-state-shooting-down-metrojet-flight-7k9268-russian-plane-flight-9268-full-youtube-video/


22 posted on 11/18/2015 9:06:21 AM PST by ctdonath2 (History does not long entrust the care of freedom to the week or the timid. - Ike)
[ Post Reply | Private Reply | To 6 | View Replies]

To: UCANSEE2
If that is the IED used to take down the Russian airliner, why is it ‘intact’ ?

This is supposedly a photo of the type of the device used or even possibly the actual device before it was detonated. At least that is what ISIS says

23 posted on 11/18/2015 9:15:34 AM PST by plain talk
[ Post Reply | Private Reply | To 20 | View Replies]

To: McGruff

The photo ISIL posted made it look like a beer or soda can.

If it was stuck in a seat back, no one probably would have paid attention. Or if a maintenance guy dropped it into a toilet, no one would have seen.


24 posted on 11/18/2015 9:15:51 AM PST by Vermont Lt (I had student debt. It came from a bank. Not from the Govt.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: hoosiermama

It would have been in the drink cart. Chances are they were not high enough for drink service to be started yet, and if they did, what are the chances a can placed at the back of the cart would have been selected.

And, the initial reports of comms about landing or turning around have been disavowed.


25 posted on 11/18/2015 9:18:10 AM PST by Vermont Lt (I had student debt. It came from a bank. Not from the Govt.)
[ Post Reply | Private Reply | To 17 | View Replies]

To: UCANSEE2; W.

Don’t know. This is where I got the pic.

https://twitter.com/katiezavadski


26 posted on 11/18/2015 9:18:33 AM PST by ButThreeLeftsDo (FreeRepublic needs your financial support.)
[ Post Reply | Private Reply | To 20 | View Replies]

To: UCANSEE2

Really?

It could be a prototype. They could have taken it before the flight? It could be a lie.

The answers to your question are self evident.


27 posted on 11/18/2015 9:19:30 AM PST by Vermont Lt (I had student debt. It came from a bank. Not from the Govt.)
[ Post Reply | Private Reply | To 20 | View Replies]

To: Vermont Lt

Cross linking Thread on can:

http://www.freerepublic.com/focus/f-news/3362005/posts


28 posted on 11/18/2015 9:24:46 AM PST by hoosiermama
[ Post Reply | Private Reply | To 25 | View Replies]

To: ClearCase_guy

29 posted on 11/18/2015 9:28:26 AM PST by Pollster1 ("Shall not be infringed" is unambiguous.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: W.

I dig, but SOMEBODY had to push the button, and if the bomb was in the control cabin, all signs would logically point to one of the crew being compromised...


30 posted on 11/18/2015 9:28:57 AM PST by W. (I piss fire and acid upon the militant muslims as they pray to their baby-raping god!)
[ Post Reply | Private Reply | To 19 | View Replies]

To: Vermont Lt; plain talk
The answers to your question are self evident.

I understand what you are saying and already thought of those answers.

My question still stands as the TEXT ON THE PHOTO says it is THE device, not THE TYPE OF DEVICE.

It also may simply be due to 'translation'.

A point made on another thread is... Why would they show it to us so we could be more prepared to prevent such bombings ? Could it be they 'gave' us that picture to throw us off to what the real bomb might look like ?

I am skeptical of everything because most of the pablum we are fed is made from cow manure.

31 posted on 11/18/2015 9:32:14 AM PST by UCANSEE2 (Lost my tagline on Flight MH370. Sorry for the inconvenience.)
[ Post Reply | Private Reply | To 27 | View Replies]

To: TXnMA

Ping.


32 posted on 11/18/2015 9:37:23 AM PST by PA Engineer (Liberate America from the Occupation Media. #2ndAmendmentMatters)
[ Post Reply | Private Reply | To 1 | View Replies]

To: McGruff
If you saw that soda can bomb ISIS posted photos of ..it could of been planted by the plane cleaning crew

You've ever been on a flight you know the cleaning crew comes on board right after landing....and there's all sorts of trash and debris to clean up on the floor and under seats

So one of the cleaning crew just conveniently leave the soda can bomb somewhere under the seat.. looking like forgotten trash

Lets face it the cleaning crew people are usually going to be the lowest people on the pecking order easiest job to get....

easiest path of least resistance to penetrate security, easiest vector to get in

33 posted on 11/18/2015 9:42:11 AM PST by tophat9000 (King G(OP)eorge III has no idea why the Americans Patr a in rebellion... teach him why)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Pollster1

‘If that’s a clock, I’m the Queen of England’: Sarah Palin


34 posted on 11/18/2015 9:42:58 AM PST by McGruff (Trump-Cruz 2016. Make America Great Again.)
[ Post Reply | Private Reply | To 29 | View Replies]

To: UCANSEE2

You a perhaps a little too literal.


35 posted on 11/18/2015 10:03:18 AM PST by Vermont Lt (I had student debt. It came from a bank. Not from the Govt.)
[ Post Reply | Private Reply | To 31 | View Replies]

To: UCANSEE2

Well... as I said it could be a photo of the actual device used. They could have taken a photo of it before they planted it. I see no reason for them to tell us what devices they are using but these people are crazy to begin with.


36 posted on 11/18/2015 10:16:22 AM PST by plain talk
[ Post Reply | Private Reply | To 31 | View Replies]

To: W.

What if it was placed into the drink cart drawer in such a way that as soon as the flight attendants began to get ready for cabin service, and slid the drawer out to count how many of each drink they had, the switch was activated by the motion of sliding the drawer out and the switch clicking against the bottom of the drawer above?


37 posted on 11/18/2015 10:54:48 AM PST by RightFighter (This space for rent)
[ Post Reply | Private Reply | To 30 | View Replies]

To: W.
I dig, but SOMEBODY had to push the button, and if the bomb was in the control cabin, all signs would logically point to one of the crew being compromised...

Nobody has to push a button.

The bomb could be triggered by either a simple timer, or an altimeter. Even more sophisticated would be a an altimeter trigger which started a timer so it would go off some time after reaching altitude.

The simple timer could go off on the ground if there are delays. The simple altimeter guarantees everyone is killed, as the aircraft blows up in flight, but most of the time it is still over land and the debris can be recovered, as happened here. The altimeter/timer combination can be set to go off over water which makes recovery and forensics much more difficult.

38 posted on 11/18/2015 2:35:57 PM PST by CurlyDave
[ Post Reply | Private Reply | To 30 | View Replies]

To: CurlyDave

I vote for theory it was some type of altimeter bomb to make the aircraft was actually in flight before the explosion , not delayed on the Tarmac

The detonation at 31k feet was the same altitude as PanAm 103 was detonated as I recall - sufficient altitude that only a relatively small explosion would set off a catastrophic and violent decompression

But rather than being on a beverage cart That could be moved, I think they would have placed it where it would blow off the tail


39 posted on 11/18/2015 3:24:01 PM PST by silverleaf (Age takes a toll: Please have exact change)
[ Post Reply | Private Reply | To 38 | View Replies]

To: McGruff; SunkenCiv; ETL
According to Kommersant the bomb was of the same type as at the apartment bombings 1999

http://www.kommersant.ru/doc/2857174

very strange, or is it?

40 posted on 11/19/2015 4:25:11 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-46 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson