Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Animated History of Poland (FULL VERSION VIDEO - 8 minutes)

Posted on 08/04/2010 3:30:43 PM PDT by lizol

click here to read article


Navigation: use the links below to view more comments.
first 1-2021-22 next last

1 posted on 08/04/2010 3:30:45 PM PDT by lizol
[ Post Reply | Private Reply | View Replies]

To: GOP_Lady; Ulysse; Protect the Bill of Rights; proudofthesouth; reaganaut; yellcam; ...

Ping


2 posted on 08/04/2010 3:31:56 PM PDT by lizol
[ Post Reply | Private Reply | To 1 | View Replies]

To: lizol

must see later.


3 posted on 08/04/2010 3:40:16 PM PDT by mel
[ Post Reply | Private Reply | To 2 | View Replies]

To: lizol
Dziękuję bardzo!!!

That was awesome, put a lump in my throat just watching it.

It's especially nice to see a country who still can celebrate their history and heritage.

4 posted on 08/04/2010 3:43:05 PM PDT by dfwgator
[ Post Reply | Private Reply | To 1 | View Replies]

To: lizol

Nice, but it gives the impression that the Polish history mainly is about different wars and being a victim.


5 posted on 08/04/2010 3:52:57 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith
Nice, but it gives the impression that the Polish history mainly is about different wars and being a victim.

Sadly, that is the truth, but I wouldn't look at it as being a victim, but fighting and ultimately overcoming adversity...and in the end prevailing as shown in the end with Warsaw's modern-day skyline, a true Phoenix literally rising from the ashes.

6 posted on 08/04/2010 3:55:47 PM PDT by dfwgator
[ Post Reply | Private Reply | To 5 | View Replies]

To: AdmSmith

They should add a few seconds concerning how the Kenyan manchild sold them down the river to the Soviets.


7 posted on 08/04/2010 3:58:07 PM PDT by newnhdad (The longest of journeys begins with one step.)
[ Post Reply | Private Reply | To 5 | View Replies]

To: lizol

Sent to Polish relatives, thanks.


8 posted on 08/04/2010 4:00:35 PM PDT by Vinnie (You're Nobody 'Til Somebody Jihads You)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

Well living between two of the most belligerent governments of all time sorta puts them in the cross hairs doesn’t it?


9 posted on 08/04/2010 4:05:48 PM PDT by Doulos1 (Bitter Clinger Forever)
[ Post Reply | Private Reply | To 5 | View Replies]

To: AdmSmith

It’s a country that literally disappeared off the map for 150 years, devoured by its neighbors.


10 posted on 08/04/2010 4:20:19 PM PDT by colorado tanker
[ Post Reply | Private Reply | To 5 | View Replies]

To: lizol

Neat animation. Thanks!


11 posted on 08/04/2010 4:24:19 PM PDT by 6SJ7 (atlasShruggedInd = TRUE)
[ Post Reply | Private Reply | To 1 | View Replies]

To: lizol
Glorioski historie Polski!

Powerful!

12 posted on 08/04/2010 4:33:27 PM PDT by higgmeister ( In the Shadow of The Big Chicken!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: lizol

Nice, except it completely glossed over the 50 years of suffering under Commie Soviet scum.


13 posted on 08/04/2010 4:39:24 PM PDT by Bon mots ("Anything you say, can and will be construed as racist...")
[ Post Reply | Private Reply | To 1 | View Replies]

To: lizol

Very nicely done. The WWII sequence, which moves rapidly from concentration camp to Battle of Britain dogfight to the Nazi banners falling from the buildings - it fills the heart with hope. And not a small amount of awe.


14 posted on 08/04/2010 4:45:24 PM PDT by Charles Martel ("Endeavor to persevere...")
[ Post Reply | Private Reply | To 1 | View Replies]

To: Charles Martel

It reminded my of this Hovis Bread ad that summed up the last 100 years in Britain.

http://www.youtube.com/watch?v=dz1a3LHSvnY


15 posted on 08/04/2010 4:48:50 PM PDT by dfwgator
[ Post Reply | Private Reply | To 14 | View Replies]

To: lizol

Breathtaking.

I actually got misty in some places.

Those guys are definitely made of sterner stuff than we are.


16 posted on 08/04/2010 5:28:56 PM PDT by VanDeKoik (Iran doesnt have a 2nd admendment. Ya see how that turned out?)
[ Post Reply | Private Reply | To 1 | View Replies]

To: VanDeKoik

Great people,smart, hardworking, patriotic, need more of them and less riffraff from the Middle east and Africa.


17 posted on 08/04/2010 6:28:43 PM PDT by ABN 505
[ Post Reply | Private Reply | To 16 | View Replies]

To: lizol

God bless Poland and her people


18 posted on 08/04/2010 8:08:11 PM PDT by Kommodor (Terrorist, Journalist or Democrat? I can't tell the difference.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: lizol

Bóg, Honor, Ojczyzna!


19 posted on 08/04/2010 10:04:42 PM PDT by dfwgator
[ Post Reply | Private Reply | To 1 | View Replies]

To: lizol

Breathtaking stuff...

I really like his “Grunwald commercial” as well - short, but brilliant.


20 posted on 08/04/2010 11:39:51 PM PDT by Kozik
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-22 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson