"“Self’ replicating implies that they are capable of producing hte energy themselves to replicate themselves.'
No it doesn't. It means that the natural processes of chemistry use available energy and raw materials to grow molecules.
"A point must be made here that the energy needed for true macroevolution would be so destructive that it would annihilate any organisms right from the start"
What the heck do you think macro evolution is?
I would like you to examine a black bear and a raccoon and list all the differences between them, then tell me how much energy it would take to change a raccoon into a bear using small changes over, let's say, 200,000 generations.
How about doing the same for a hippo and a whale.
"As well, they had to isolate the wrong left handed amino acids from hte right hand ones because the combining of the two destroyed the ones needed to create viable amino acids capable of existing in highly controlled lab environments. Just a little diddy that not many people are aware of when discussing the ‘amino acids from chemical’ experiments that were carried out for decades."
Where do you get this nonsense?
Please give me the link to your source for this.
Amino acids have been found in space, on meteorites and have been produced through simple lab experiments, including simulations of space where ice is bathed in ultraviolet light, and in 'concussion' experiments. Amino acids form in all kinds of natural situations.
Your diddy is wrong.
[[No it doesn’t. It means that the natural processes of chemistry use available energy and raw materials to grow molecules.]]
Thank you for validating hte fact that cells aren’t ‘self’ replicating.
[[I would like you to examine a black bear and a raccoon and list all the differences between them, then tell me how much energy it would take to change a raccoon into a bear using small changes over, let’s say, 200,000 generations.]
2 watts
[[How about doing the same for a hippo and a whale.]
3.27 watts
[[Amino acids have been found in space, on meteorites and have been produced through simple lab experiments, including simulations of space where ice is bathed in ultraviolet light, and in ‘concussion’ experiments. Amino acids form in all kinds of natural situations.
Your diddy is wrong.]]
No it isn’t- you can look up the miller experiments yourself, but here’s a primer http://www.answersingenesis.org/tj/v18/i2/abiogenesis.asp
[[Actually those calculations assume that the entire gene appears at once.
GATCTGTCTATAGTCTATGTGTAACA
The probability of the above string forming all at once is .222x10-16. This is the type of calculation you and your sources use.
Assuming only SN changes, what should be calculated is the probability of changing an existing gene into a new gene.
Original gene:
GAACTGTCTATAGACTATGTGAAACA
target gene:
GATCTGTCTATAGTCTATGTGTAACA
The probability of changing the original to the target is .111
Big difference.
Now the kicker - neither calculation tells us a damn thing about biology, they simply don’t reflect reality.]]
You’re describing Microevolution- not Macroevolution- the calculations deal with Macro- not Micro, as well, you shopw nothign about whether that change is a ‘positive’ change or not, you just simply illustrate change- The Wistar calculations dealt with the probabilities of positive mutations advancing a species beyond it’s own kind, not in Microevolution
[[You seem to be stuck in the idea that the only way macro evolution could happen is through some radical saltation event. Something like a theropod suddenly developing wings, modified ribs, and a more efficient cardio-vascular system all in one generation. Is that what you believe?]]
No- Macroevolution is gain of NEW non species specific information, notr simply on alterations of existing informaiton- NEW non species specific information would have to be introduced from a dissimilar species such as in lateral gene transference- You and I have been over htis many a time here on FR
[[Behe’s Irreducible Complexity is irrelevant because it deals exclusively with how to break something not how to not build something.]]
Actually htat’s not true- He shows why it would be impossible to construct fully functioning systems from scratch, and then goes on to show why it would not be able to be built piecemeal but had to be created and assembled all at once- thjis really is the crux of ID- they don’t just show why somethign is irreducible, they also explain that piecemeal conbstruction from random mutations would never succeed in buolding htese irreducibly dcomplex systems.
[[If you want evidence of the ability of biological systems to change function look up the precursor to hemoglobin]]
Noone is talking about changing fucntions- we’re talking about irreducibly complex systems- there’s a difference. Hemoglobin has absolutely nothign to do with irreducibly complex systems such as the eye or hearing or any other number of irreducibly complex systems. While it might be itneresting to contemplate describing events for which there is absolutely no evidence to show for, the ‘rebuttles’ to specified complexity are nothign more than conjecture based on assumptions with no evidence ot support hte ideas whereas ID CAN be tested to show that a removal of a component WILL cause a breakdown.
[[Yes. If you would bother reading the work done by scientists who work in the fields referenced by Dembski and Behe, including mathematicians and biologists who understand the theory and the practical consequences of Dembski and Behe’s work as well as Dembski and Behe do, you would not be asking that question.]]
As you well know- their rebuttles to Demski and Behe have themselves been rebuttled.
[[Dembski’s CSI and Behe’s IC have been debunked multiple times.]]
That’s not true
[[Every time Behe comes up with a supposed Irreducibly Complex system (which is really inapplicable the way it is normally defined) a number of scientists show that the system can evolve.]]
No sir- a number of scienctists come up with putative corrections to their own hypothesis, and tailor them based on assumptions- The matter is far from debinked- As you well know- Science is a constant process of reevaluation, and it is also a science abotu hte past- not about known absolutes- although ID science is about testing and measuring knowns. Behe’s ID has not been debunked- far from it. The scientists come up with ASSUMPTIONS about systems with absolutely NO evidence to back up their assumptions that these irreducibly complex systems could have been built- to suggest htat they have is simply wrong.
js1138 [[Interesting. Cells produce their own energy?]]
No, I said that to suggest cells are capable of ‘self’ replication is to suggest that they can produce hteir own energy necessary for the changes.
[[I’m still waiting for you or someone to show us the magic flaw in descent with modification. Bring it on. Imagine the look on the faces of the tens or thousands of PhD biologists, chemists, physicists, astronomers, geologists, when you show up with your strenuous look]]
As I said it wouldn’t even phase them as they’ve been brought the scientific evidence that it is biologically impossible, yet they still beleive that a single chance of 10 to hte 300’th or so power is enough to account for hte trillions of other biologically impossible changes. If there’s a ‘glimmer of hope’ somehwere, anwhere, then to them it’s entirely possible the vast vast intelligently designed systems with hteir vast highly specified complexities was created through such a dim weak probability of chance. Hence 150 years of insistence that the biolgical infeasible system is feasible.