Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Russian State TV Spreads Crazy Coronavirus Conspiracy Theories [Blames President Trump.]
RFE/RL (Kyiv, Ukraine) ^ | February 7, 2020 | Ray Furlong

Posted on 02/08/2020 4:00:10 PM PST by familyop

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-55 last
To: NorseViking; familyop
Hi NorseViking, http://katyusha.org/view?id=13538 a Russian site writes that the Chinese military is claiming the virus was artificially produced in U.S. laboratories with the goal of breaking China from within. It further suggests that the outbreak is a U.S. bio weaponry operation.

RIA Katyusha is Russian media, but does it mean that you trust them?

41 posted on 02/09/2020 8:32:54 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 31 | View Replies]

To: AdmSmith

I don’t know anything about the source you cited but judging their content it is a right-wing tabloid.

I have no idea are they correct or not regarding Chinese claims. I don’t know the author of the piece you linked as well to judge is he or she credible or not.

Maybe you’d link to Alex Jones to check out his take on this virus situation and then we’d say he is an ‘American’ source?

All I know is that RFE misinterpreted and sensantionalized in the publication originally discussed on this tread.
I think I explained why in previous posts.


42 posted on 02/09/2020 10:02:54 AM PST by NorseViking
[ Post Reply | Private Reply | To 41 | View Replies]

To: NorseViking
Although you now is going into the Whataboutism,
https://en.wikipedia.org/wiki/Whataboutism

But, I forgive you if you give the link to the RFE article and why it was wrong.

43 posted on 02/09/2020 10:46:49 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 42 | View Replies]

To: AdmSmith

You are currently on tread discussing it!
See post #1 from the original poster, AdmSmith.
I explained why I disagree with it in several posts. Do you want me to repost it once again?

Then you posted unrelated link to a conspiracy website which is not even a legit media to argue my points.
That is the very definition of whataboutism but it is yours.
That is why I am asking why not Alex Jones?

I said RFE lies claiming the things outlined in the headline to this tread.
I didn’t say the website you linked isn’t pushing conspiracy.
Is it understood?


44 posted on 02/09/2020 11:11:10 AM PST by NorseViking
[ Post Reply | Private Reply | To 43 | View Replies]

To: MadMax, the Grinning Reaper; piasa
Council for the National Interest: founded in 1989 by former Congressman Paul Findley (pro-PLO) and Pete McCloskey (Vietnam antiwar movement background) and former Presidential candidate John Anderson (Vietnam antiwar movement).

Ray McGovern: far-left Catholic from Georgetown who hated St. John Paul II and stands during Mass to demand ordination of women; retired from CIA in 1990 to become career critic of CIA and defender of Russian foreign policy; blamed Israel for 9/11 and Iraq War; founded Veteran Intelligence Professionals for Sanity (VIPS) in January 2003; became actively involved in Joseph Wilson's Nigergate disinformation campaign; put on State Department watchlist in 2011 for disrupting speech by Secretary of State Hillary Clinton; gave Edward Snowden an award in Moscow in 2013; organized VIPS protest against CIA for torture in 2015; also in 2015 coordinated VIPS letter urging Angela Merkel to be suspicious of U.S. intelligence claims in Ukraine; supported Jill Stein in 2016, disrupted Gina Haspel's confirmation in 2018.

David MacMichael: retired from CIA in 1983 to become vocal opponent of Ronald Reagan's Middle Eastern policy and critic of CIA; did investigations for Christic Institute; investigated by the FBI for his contact with the IPS-linked pro-Sandinista groups the Council on Hemispheric Affairs (COHA, tied to the Soviet front the World Peace Council and Communist agent Orlando Letelier) and the Center for Development Policy (CDP, cofounded by Letelier) in the 1980s; in 1989 founded the Association of National Security Alumni (ANSA), which partnered at a January 1993 Moscow conference with longtime CIA critic Victor Marchetti and retired KGB agents from the Association of Foreign Intelligence Veterans Association (aka Foreign Intelligence Veterans Association, FIVA) in calling for intelligence "reforms"; cofounded VIPS with McGovern in 2003 and has supported VIPS since then.

I think you might be thinking of Victor Marchetti with some of your comments on Halperin, Borosage, Agee. But MacMichael and McGovern are in the same tradition and grew out of Marchetti's operation.

45 posted on 02/09/2020 11:24:19 AM PST by Fedora
[ Post Reply | Private Reply | To 39 | View Replies]

To: Fedora

PS: Should add that some of McGovern’s work appeared in Lyndon LaRouche’s EIR bulletin.


46 posted on 02/09/2020 11:25:36 AM PST by Fedora
[ Post Reply | Private Reply | To 45 | View Replies]

To: NorseViking

Actually, I was referring to what you said about RFE in #31, do you have a link to that article?


47 posted on 02/09/2020 11:30:02 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 44 | View Replies]

To: AdmSmith

Familyop posted it!

Here it is once again:

https://www.rferl.org/a/russian-state-tv-spreads-baseless-coronavirus-conspiracy-theories/30422879.html


48 posted on 02/09/2020 11:35:34 AM PST by NorseViking
[ Post Reply | Private Reply | To 47 | View Replies]

To: NorseViking

You are misunderstanding, I was referring to what you said about RFE in
https://www.freerepublic.com/focus/news/3814886/posts?page=31#31


49 posted on 02/09/2020 11:46:35 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 48 | View Replies]

To: AdmSmith

I am saying just that. Sorry, don’t understand what else do you want to hear.


50 posted on 02/09/2020 11:49:50 AM PST by NorseViking
[ Post Reply | Private Reply | To 49 | View Replies]

To: NorseViking
I didn’t say the website you linked isn’t pushing conspiracy.

So we agree that http://katyusha.org/view?id=13538 is crap. But it is not the only website in Russia pushing this, for instance https://rossaprimavera.ru/news/b222dc39

https://lv.sputniknews.ru/radio/20180912/9375813/nikulin-vspyshki-achs-rezultat-provodimoj-ssha-biologicheskoj-vojny.html

https://www.pravda.ru/videochannel/1395511-igor_nikulin/

and
https://pravda-nn.ru/news/genetika-ili-biologicheskoe-oruzhie-komu-vygodna-vspyshka-smertelnogo-koronovirusa/

Do you agree that these as well are crap?

51 posted on 02/09/2020 12:41:17 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 50 | View Replies]

To: AdmSmith

Katyusha seems like a click bait website. I don’t see any company or authors behind it, it is not registered with Roskomnadzor as a media but there are forms through which they receive donations. They expect readers to support them.
Buy by the way I checked their reference to a former Chinese officer about SARS and it is correct. This guy is a real person and he has a blog which is cited correctly.

Primavera and Sputnik cite an ‘expert’ who says virus might be a bio weapon but the article doesn’t say if the authors agree or not.

Pravda says US used to develop bio weapons in Third world countries but without connections to coronavirus. Their article includes instructions on how to protect yourself.

Pravda NN describes several versions of virus Outbreak, including US or Chinese bio weapon. They themselves admit both versions are more in a conspiracy theory.

To me all of the above is more like journalism even 8s sensationalist sometimes.
It is how reporters work.


52 posted on 02/09/2020 1:10:20 PM PST by NorseViking
[ Post Reply | Private Reply | To 51 | View Replies]

To: NorseViking
To me all of the above is more like journalism even 8s sensationalist sometimes.

Then we have different opinion about how journalists should work.

The Chinese officer is PLA Spokesperson Colonel Dai Xu that in the article said SARS was linked to H5NO
https://www.kp.ru/daily/26061/2970592/ but this either shows that the Russian writers in kp.ru and Katyusha are not checking anything regarding things that they have no knowledge about, or are just rewriting info given to them from “the propaganda department.”

Anyone checking the text would have noticed 1) there is no H7N0 influenza virus (but a H7N9 https://en.wikipedia.org/wiki/Influenza_A_virus_subtype_H7N9 ) and
2) influensa virus are negative- and coronavirus are positive-sensed RNA viruses.

In other words just crap.

53 posted on 02/09/2020 2:00:51 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 52 | View Replies]

sorry, a typo: H5NO => H7N0


54 posted on 02/09/2020 2:03:37 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 53 | View Replies]

To: AdmSmith

LOL. What are you basing your journalism standards on?
US media? Thanks for a laughs!
Look at the publication discussed on tread and then the whole Trump collusion story.
All based on lies or grotesque misinterpretation of facts and peddled by real American media.
Then you are linking an anonymous conspiracy blog designed to look like a news website and scream ‘Russian government propaganda’ and talking about journalist standards.
As for Dai Hu and SARS it was initially published by Daily Mail of UK.
Ever heard about normalcy bias?


55 posted on 02/09/2020 7:16:16 PM PST by NorseViking
[ Post Reply | Private Reply | To 53 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-55 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson