Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Journalists in Chinese state media to be tested on loyalty to President Xi Jinping
South China Morning Post (Hong Kong) ^ | 19 Sep 2019 | William Zheng

Posted on 09/20/2019 6:52:39 AM PDT by BeauBo

Nationwide exams – with sections on Xi’s political thinking and Marxism – will be held later and press cards will only be issued to those who pass.

Thousands of reporters and editors working in Chinese state media will have to sit a nationwide exam to test their loyalty to President Xi Jinping.

Some will be asked to take part in “pilot tests” in early October, before the exams are held nationwide, according to a notice late last month from the media oversight office of the Communist Party’s propaganda department...

it is an example of the party using tech to strengthen its ideological control in China...

The media oversight office made clear that updated press cards, which are essential for those working in the industry, would only be issued to journalists who had passed the exam. Those who fail will have one chance to take the test again.

(Excerpt) Read more at scmp.com ...


TOPICS: Culture/Society; Foreign Affairs
KEYWORDS: censorship; china; media
Sounds like Twitter.

They may have led the ChiComs down this path, with their political correctness tests.

1 posted on 09/20/2019 6:52:39 AM PDT by BeauBo
[ Post Reply | Private Reply | View Replies]

To: BeauBo

Unfortunately any legitimate journalists in China tend to end up before a Judge for reporting on what those in power want hushed up.


2 posted on 09/20/2019 6:57:10 AM PDT by BBQToadRibs
[ Post Reply | Private Reply | To 1 | View Replies]

To: BeauBo
Whatever happened to this beautiful girl, Liang Xiangyi?


3 posted on 09/20/2019 6:57:42 AM PDT by real saxophonist (Yeah, well, y'know that's just like, uh... your opinion, man.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: BeauBo

GayMuzzie could have pulled this and he woudda got 100% compliance:

Man, they would have been slobbering, RIPPING on them kneepads.


4 posted on 09/20/2019 6:58:19 AM PDT by gaijin
[ Post Reply | Private Reply | To 1 | View Replies]

To: BeauBo
Goebbels would be proud. Google, Twitter, Face Book, and You Tube to adopt this idea to ensure loyalty to the Clown Car of Candidates for any posters.
5 posted on 09/20/2019 7:11:54 AM PDT by nuke_road_warrior (Making the world safe for nuclear power for over 20 years)
[ Post Reply | Private Reply | To 1 | View Replies]

To: BeauBo

Oh yeah, he’s a great guy.


6 posted on 09/20/2019 7:13:16 AM PDT by AppyPappy (How many fingers am I holding up, Winston?)
[ Post Reply | Private Reply | To 1 | View Replies]

To: real saxophonist

“Whatever happened to this beautiful girl, Liang Xiangyi?”

She is working at Yicai Global, a Financial News Network.

She was rolling her eyes over the other dumb reporter’s over the top butt kissing - not the wondrous elaborations of a beloved Party spokesmen.

Just jealous, I guess.


7 posted on 09/20/2019 7:21:05 AM PDT by BeauBo
[ Post Reply | Private Reply | To 3 | View Replies]

To: BeauBo

I remember when that happened, many here said she would ‘disappear’ within a week. Glad that’s not the case.


8 posted on 09/20/2019 7:24:33 AM PDT by real saxophonist (Yeah, well, y'know that's just like, uh... your opinion, man.)
[ Post Reply | Private Reply | To 7 | View Replies]

To: real saxophonist

You see why Hong Kong doesn’t want to be ruled by the mainland.


9 posted on 09/20/2019 7:51:39 AM PDT by CondorFlight
[ Post Reply | Private Reply | To 8 | View Replies]

To: BeauBo

They get them from a Chinese flag factory. Have you tried to find a flag lately that doesn’t have a ‘Made in China’ label on it?


10 posted on 09/20/2019 7:52:41 AM PDT by pgkdan (The Silent Majority STILL Stands With TRUMP! WWG1WGA)
[ Post Reply | Private Reply | To 1 | View Replies]

To: BeauBo

Methinks the dragon is far too along and it’s capitalistic leanings to be dragged back into it totalitarian dictatorship again

we shall see

It’s going to get more and more difficult in today’s modern world to be a dictator of the very large and influential country


11 posted on 09/20/2019 8:24:02 AM PDT by Truthoverpower (The guvmint you get is the Trump winning express !)
[ Post Reply | Private Reply | To 1 | View Replies]

To: nuke_road_warrior
Goebbels would be proud. Google, Twitter, Face Book, and You Tube to adopt this idea to ensure loyalty to the Clown Car of Candidates for any posters.

BUMP!

12 posted on 09/20/2019 9:36:38 AM PDT by PGalt
[ Post Reply | Private Reply | To 5 | View Replies]

To: BeauBo; SunkenCiv; AmericanInTokyo; caww; nuconvert

On the 19th Communist Party Congress in October (24th) 2017 “Xi Jinping Thought” was enshrined into the Constitution of the Communist Party of China and everyone is compelled to learn it.

The 14 points are described here https://en.wikipedia.org/wiki/Xi_Jinping_Thought

As Xi has replaced Mao as the guiding father of the Communist Party it is important to know more about his background. Jane Perlez, former Beijing Bureau Chief for The New York Times, witnessed Xi Jinping’s rise to power during her seven years reporting from China. Her podcast, On the Trail of Xi Jinping, follows China’s current leader, and how the West got him so wrong.

podcast https://podcasts.apple.com/us/podcast/on-the-trail-of-xi-jinping/id986803207?i=1000460091968

Transcript https://shorensteincenter.org/transcript-trail-xi-jinping/

In a speech Xi, citing Karl Marx and Friedrich Engels, said socialism would triumph over capitalism but cited Deng Xiaoping as saying that it would be a long historical process, which would probably take several dozens of generations. He warned that the collapse of the Soviet Union served as a painful lesson for the party. The underlying reason for the collapse was that the Soviet Communist Party had lost its ideological controls, he said.
https://www.scmp.com/week-asia/opinion/article/3004897/xi-jinpings-speech-shows-chinas-communist-party-still-haunted

The Chinese Communist Party was founded 23JUL1921 https://en.wikipedia.org/wiki/Communist_Party_of_China

In other words 2021 will be a very important year for them. For that celebration, Xi needs something big, is it just a complete advanced authoritarian system with full use of not just the police but high tech surveillance facial recognition, or something else? Unification with Hong Kong, or a more riskier move against Taiwan?

China is targeting the 11JAN20 election in Taiwan. Taiwan is ramping up efforts ahead of the election to combat fake news and disinformation that the government says China is bombarding the island with to undermine its democracy.

https://www.reuters.com/article/us-taiwan-election-media/chinese-rumors-and-cyber-armies-taiwan-fights-election-fake-news-idUSKBN1YL2MF


13 posted on 12/25/2019 6:44:36 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: real saxophonist

Good question, just did a quick search and on Twitter...nada


14 posted on 12/25/2019 6:49:13 AM PST by Tea Party Terrorist (If you watch porn you support human trafficking.)
[ Post Reply | Private Reply | To 3 | View Replies]

To: BeauBo

Same as it ever was.

15 posted on 12/25/2019 6:57:03 AM PST by Tijeras_Slim
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tijeras_Slim

They should get CNN, MSNBC and the rest to take it.

I bet they would all pass.


16 posted on 12/25/2019 7:23:20 AM PST by slorunner
[ Post Reply | Private Reply | To 15 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson