Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

North Korean Leader Kim Jong-un Is Set To Meet South Korean President Moon Live DMZ
Twitter ^ | 04/26/18

Posted on 04/26/2018 5:25:57 PM PDT by Enlightened1

This is at the DMZ right now.  The North Korean Dictator is about to cross over into South Korea at the DMZ.

https://twitter.com/i/events/971974473560674305

(Excerpt) Read more at twitter.com ...


TOPICS: Breaking News; Constitution/Conservatism; Foreign Affairs; News/Current Events; War on Terror
KEYWORDS: dmz; kim; kimjongun; korea; meeting; moon; nkorea; northkorea; obfuscation; sneaky; southkorea; trumpasia
Navigation: use the links below to view more comments.
first previous 1-20 ... 41-6061-8081-100101-108 next last
To: TXnMA

You could be right.

Very probably not though.

And we will see.

These wonderful photos posted (of two socialists hand in hand) have already occurred at Sunan Airport in years past for both Kim (DAE Jung) and Ro. Nothing’s changed, I assert. Nothing is really new. (Not short of regime change it isn’t. )


61 posted on 04/26/2018 8:34:53 PM PDT by AmericanInTokyo
[ Post Reply | Private Reply | To 53 | View Replies]

To: AmericanInTokyo

2 things have changed (in the last decade):
China and Russia want NK’s excellent all-weather ports developed.
Everyone wants to employ NK’s disciplined, cheap labor.


62 posted on 04/26/2018 8:43:02 PM PDT by mrsmith (Dumb sluts: Lifeblood of the Media, Backbone of the Democrat/RINO Party!)
[ Post Reply | Private Reply | To 61 | View Replies]

To: mrsmith

That’s the dirty little secret, is that Nork labor is used in a lot of places. Even countries, like Poland.


63 posted on 04/26/2018 8:53:04 PM PDT by dfwgator (Endut! Hoch Hech!)
[ Post Reply | Private Reply | To 62 | View Replies]

To: AmericanInTokyo

Let’s not forget UN is still a cold blooded dictator who has killed his own uncle and other relatives, not to speak of killing and starving his own people.

Also there can’t be two leaders of N..Korea... if unified. So hows that going to work?


64 posted on 04/26/2018 8:58:11 PM PDT by caww
[ Post Reply | Private Reply | To 38 | View Replies]

To: dragnet2

Trump is 100% the reason these have gotten this far...I think he told them both you either work it out fast or I’m bombing the daylights out of the north.

However....so far it’s still just talk.....and UN wants our troops out of the south and a guarantee his government will stay in place.


65 posted on 04/26/2018 9:02:23 PM PDT by caww
[ Post Reply | Private Reply | To 49 | View Replies]

To: dfwgator

surprised they’re much used in Poland.
They’re very much used in the MidEast.

But why should Kim be happy to sell them out for a buck a day when he can get ten times as much from them in NK factories? -If he lets investors build those factories.


66 posted on 04/26/2018 9:06:41 PM PDT by mrsmith (Dumb sluts: Lifeblood of the Media, Backbone of the Democrat/RINO Party!)
[ Post Reply | Private Reply | To 63 | View Replies]

To: caww
And it begins!

President Moon Jae-in and Kim Jong Un attend the inter-Korean summit at the truce village of Panmunjom Peace House, April 27, 2018.


67 posted on 04/26/2018 9:09:54 PM PDT by caww
[ Post Reply | Private Reply | To 65 | View Replies]

To: GnuThere

They should get him on AF1 and take him to Vegas. That’d blow his mind.


68 posted on 04/26/2018 9:16:55 PM PDT by PLMerite ("They say that we were Cold Warriors. Yes, and a bloody good show, too." - Robert Conquest)
[ Post Reply | Private Reply | To 29 | View Replies]

To: Enlightened1
Watched LIVE on FOX BUSINESS NETWORK...and was very interesting...

Really looking forward to our POTUS, DJT going to the Korea Summit and making HISTORY..Hope Mike Pompeo gets it set up and ready to roll soon...
We need New News and time to shut this over sexed CNN DOWN...

BY THE WAY...heard on Shannon Bream that little Tommy Brokaw had some sex hankie panky going on in the 1990...of course he denies it...so will the liberals, report on that or will they cover up????

69 posted on 04/26/2018 9:16:57 PM PDT by haircutter
[ Post Reply | Private Reply | To 1 | View Replies]

To: caww
First talks end as they break now for lunch........


70 posted on 04/26/2018 9:21:08 PM PDT by caww
[ Post Reply | Private Reply | To 67 | View Replies]

To: caww

Trump needs to keep up with maximum pressure on both north and south. South Korean government is full commie and is willing to reunite with north under the communist rule. People on the right have been under constant brain washing by the media and opposition leaders are being put in prison one by one. It’s quite breathtaking what’s happening under Moon presidency. Moon is outdoing Obama. Also, no one in the north knew about this meeting until some “illegally” heard on RFA, radio free Asia. Most still don’t know about it.


71 posted on 04/26/2018 9:26:31 PM PDT by Sedona13
[ Post Reply | Private Reply | To 65 | View Replies]

To: PLMerite

He would never leave. It would be hookers and buffets 24/7 since he’s a known hedonist.
This is actually a brilliant idea that would free a lot of Norks!


72 posted on 04/26/2018 9:40:47 PM PDT by GnuThere
[ Post Reply | Private Reply | To 68 | View Replies]

To: hattend

I wonder who is going to nominate President Trump for a Nobel Peace Prize? Not that he needs the money.
_______________________________________________

Considering he would be in company with the likes of Al Gore, Nelson Mandela, Yasser Arafat and Barak Obama, I’m not sure he would consider it an honer.


73 posted on 04/26/2018 10:09:28 PM PDT by Gideon300
[ Post Reply | Private Reply | To 28 | View Replies]

To: AmericanInTokyo

>> Context people! History people!

Kim is losing his shirt.


74 posted on 04/26/2018 10:15:39 PM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 35 | View Replies]

To: Extremely Extreme Extremist

>> should be on every channel

Disney and Comcast hate Trump, conservatives — not gonna happen.


75 posted on 04/26/2018 10:17:15 PM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 12 | View Replies]

To: AmericanInTokyo
As I said, you apparently unaware of the drastic changes (Trump's doing) that have taken place in the internal DPRK power structure of late. When what has happened is finally announced, KJU's behavior will make sense.

Were you aware (I watched it live) that, after KJU crossed into SK (first time for a NK leader in >60 years), he surprised Moon?.

Look at the photo in #54.

KJU -- unexpectedly -- invited Moon to accompany him into the DPRK -- and they did so, hand-in hand.

For KJU, going to SK was, "I went to your meeting." (a small concession...)

The unexpected reverse invitation was a huge risk of "Face" for Kim Jong Un.

~~~~~~~~~~~~~~

We've both lived in Japan for several years.

Think about it...

TXnMA
 

76 posted on 04/26/2018 10:17:37 PM PDT by TXnMA ("Allah": Satan's current alias; "0bama": Allah's stooge; "Moderate Muslims": Allah's useful idiots.)
[ Post Reply | Private Reply | To 61 | View Replies]

To: TXnMA

Oh good lord.

Save. This. Thread v


77 posted on 04/26/2018 11:57:28 PM PDT by AmericanInTokyo
[ Post Reply | Private Reply | To 76 | View Replies]

To: AmericanInTokyo
And what might be your own credentials

I don't need no stinking credentials.☺

You say, ""It’s all show and BS. Kim is not sincere. Mark my word""

Because you're this big credentialed expert, right? Gezzzz.

Like all the political experts, networks, pundits, commentators and journalist who had Trump and the 2016 election 100% wrong? I've seen you experts in action. lol...

There are going to be a lot of people chowing down on crow around here.☺

78 posted on 04/27/2018 12:30:27 AM PDT by dragnet2 (Diversion and evasion are tools of deceit)
[ Post Reply | Private Reply | To 59 | View Replies]

To: dragnet2

Good job!


79 posted on 04/27/2018 12:51:02 AM PDT by EliRoom8
[ Post Reply | Private Reply | To 78 | View Replies]

To: AmericanInTokyo; TigerLikesRooster

We should not forget:
Otto Warmbier’s parents sue North Korea over son’s death

https://edition.cnn.com/2018/04/26/politics/otto-warmbier-family-lawsuit-north-korea/index.html


80 posted on 04/27/2018 1:07:52 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 59 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 41-6061-8081-100101-108 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson