Free Republic
Browse · Search
News/Activism
Topics · Post Article

To: ETL; The Westerner; lodi90; TigerLikesRooster

The 9 Russian Words That Explain KremlinGate
It’s International Talk Like a Chekist Day—here’s a quick primer on kombinatsiya, konspiratsiya and more
http://observer.com/2017/03/kremlingate-russia-spy-game-disinformation/


20 posted on 04/05/2017 7:04:57 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 19 | View Replies ]


To: AdmSmith

Sorry, Schindler has gone full foaming at the mouth Eichenwald. I don’t find him credible at all at the moment. Too bad.


21 posted on 04/05/2017 9:01:50 AM PDT by lodi90
[ Post Reply | Private Reply | To 20 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson