Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

MH17 report 2015: Families warned of its ‘distressing’ nature as it could change the way we fly
News.com.au ^ | OCTOBER 13, 2015 | Robyn Ironside

Posted on 10/13/2015 2:00:27 AM PDT by AdmSmith

Data from black boxes, satellite imagery and photos from the crash site were expected to feature throughout the report and findings would be “based on objective analysis of available evidence”, the briefing note said. “The purpose of the report is to determine the cause of the accident, not identify who was responsible,” it said.

The online sharing tool was launched in April, giving airlines up to date information about the airspace status of countries such as Afghanistan, Iraq, Syria, Ukraine, Egypt, Yemen and Mali.

Other recommendations by the taskforce regarding conflict zone risk, included a comprehensive review of existing requirements and message formats, and industry led initiatives to share operational information and be more transparent with passengers.

(Excerpt) Read more at news.com.au ...


TOPICS: Crime/Corruption; Extended News; Foreign Affairs; Russia
KEYWORDS: astroturf; mh17; putinsbuttboys; russia; russianstooges; ukraine; ukrainecrisis; vladtheimploder
The report will be issued today.
1 posted on 10/13/2015 2:00:27 AM PDT by AdmSmith
[ Post Reply | Private Reply | View Replies]

To: AdmSmith

More here http://www.bbc.com/news/world-europe-34511973


2 posted on 10/13/2015 2:01:19 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

There will be a lot of wacky conspiracy theories to distract. RT and Sputnik will publish some of them and the Trolls will repost them.

In the meantime here are some of the conspiracy theories:

1. Israel assisted the Ukrainian shoot down of MH17 by using an F-15E plane out of Azerbaijan as an airborne radar system, allowing a Ukrainian SU-22 to target the passenger plane. Poroshenko was acting under the orders of Israeli Prime Minister Benjamin Netanyahu.

2. The Illuminati/New World Order/Satan downed MH17 in a false flag attempt, with Russia, Ukraine, and all other major countries in the world complicit in the disaster.

3. MH17 never existed. No plane ever crashed. The West transported debris into a poultry farm in the village of Grabovo, spread it out, and said that a plane was shot down. There are no victims, and all of the relatives are lying crisis actors. Russia always knew that there was never an actual plane crash, but could not say this without coming across as heartless, so they put together a series of ineffective retorts to the West regarding SU-25 planes, a Ukrainian Buk, and so on. However, none of these worked, and Russia has been outmaneuvered in a grand conspiracy.

4. Occult forces guided by the IMF and its head, Christine Lagarde, orchestrated the downing of MH17, as proven by the event’s connections to numerology. This allegation is irrefutable due to the repetition of the number 7 (MH-17, 7/17/2014, Boeing 777), an occult number that was discussed by Lagarde in a 2014 speech.

5. The West framed Russia and its separatists for MH17 by repainting and planting the debris of a previously crashed plane in the fields of eastern Ukraine. This flight was likely British Airways Flight 38, which crashed outside of London Heathrow airport during a botched landing. MH17 disappeared (along with its 298 souls) and no one knows where it is now, if it ever even existed.

6. Ukraine and its Western, Modi-hating backers shot down MH17, thinking down the flight was actually the plane carrying Indian Prime Minister Narendra Modi from Frankfur

7. The Illuminati shot down MH17 in order to kill AIDS researchers

8. A Chinese crew shot down MH17 with an anti-air missile, and Putin knows about it, thus causing a supposed cool down in Sino-Russian relationship building. A Chinese crew used an HQ-16, a Chinese mid-range surface-to-air missile system. Oh, and China also shot down MH370 too, probably with an HQ-16 as well.

More on these theories and links:
https://www.bellingcat.com/news/uk-and-europe/2015/08/07/mh17-conspiracies/

Please add more conspiracy theories and we can have a vote on the most odd in a few days.


3 posted on 10/13/2015 2:10:31 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Trumpinator; mac_truck; McGruff; tcrlaf; Navy Patriot; marvel5; exPBRrat; Lucy Hamilton; ...

Please feel free to add more conspiracy theories here.


4 posted on 10/13/2015 2:12:16 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 3 | View Replies]

To: AdmSmith
A Russian state-controlled missile-maker says its own investigation of last year's crash of the MH17 airliner over rebel eastern Ukraine contradicts conclusions from a Dutch probe.

http://news.yahoo.com/russian-missile-maker-contradicts-dutch-mh17-crash-report-074426278.html

Interesting, the report is not yet published!

5 posted on 10/13/2015 2:19:40 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 4 | View Replies]

To: AdmSmith

Well, one conspiracy theory that will fall by the wayside will be, “WHY HAVEN’T THEY RELEASED THE REPORT?” I saw that one just a week or so ago.


6 posted on 10/13/2015 2:21:05 AM PDT by 1rudeboy
[ Post Reply | Private Reply | To 3 | View Replies]

To: AdmSmith

Oh, the “Ukraine was targeting Putin” one was pretty good. And don’t forget that Spanish air-controller who never existed.


7 posted on 10/13/2015 2:23:00 AM PDT by 1rudeboy
[ Post Reply | Private Reply | To 3 | View Replies]

To: AdmSmith
Did they find the guy the directed the plane over an active combat zone?
8 posted on 10/13/2015 2:25:10 AM PDT by McGruff (Trump-Cruz 2016. Make America Great Again.)
[ Post Reply | Private Reply | To 3 | View Replies]

To: McGruff

Which one? The one who directed the 20 other flights over the same area that day?


9 posted on 10/13/2015 2:30:00 AM PDT by 1rudeboy
[ Post Reply | Private Reply | To 8 | View Replies]

To: McGruff

Oh, and didn’t RT tweet that it was John McCain?


10 posted on 10/13/2015 2:31:04 AM PDT by 1rudeboy
[ Post Reply | Private Reply | To 8 | View Replies]

To: AdmSmith

I can buy a false flag to increase tensions between countries.


11 posted on 10/13/2015 3:12:59 AM PDT by Jonty30 (What Islam and secularism have in common is that they are both death cults)
[ Post Reply | Private Reply | To 3 | View Replies]

To: AdmSmith
I'm surprised no one has suggested that it was just an accidental fuel tank explosion.

Was the plane similar in design in anyway to Flight 800?

12 posted on 10/13/2015 3:29:24 AM PDT by who_would_fardels_bear
[ Post Reply | Private Reply | To 3 | View Replies]

To: AdmSmith

9. Fred and Barney got into a fight using stinger missiles. Cry havoc ensued!!!!!!!!!!!!


13 posted on 10/13/2015 4:07:18 AM PDT by brivette
[ Post Reply | Private Reply | To 3 | View Replies]

To: AdmSmith

I like #7: The Illuminati downed MH17 to suppress AIDS research, LOL.


14 posted on 10/13/2015 5:32:52 AM PDT by Pearls Before Swine
[ Post Reply | Private Reply | To 3 | View Replies]

Comment #15 Removed by Moderator

To: AdmSmith

CNN’s Don “Wackjob” Lemmon:

“Is It Preposterous’ to Think a Black Hole Caused Flight 370 to Go Missing?”

http://3.bp.blogspot.com/-qkfu18suQKg/UsJ9LynDLcI/AAAAAAAAASo/42OG6An031I/s320/Chelsea-WebbHubbell-Morph.gif


16 posted on 10/13/2015 7:36:13 AM PDT by Carriage Hill ( The cheddar cheese slid off my cracker, a long time ago.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: AdmSmith
Here is my favorite one:

Ukrainians wanted to shoot down Putin's plane that was flying nearby, but accidentally shot down MH17. It was reported by RT.


17 posted on 10/13/2015 9:00:14 AM PDT by Krosan
[ Post Reply | Private Reply | To 3 | View Replies]

To: Krosan

Vlad, you’re killing me...


18 posted on 10/13/2015 12:16:04 PM PDT by brivette
[ Post Reply | Private Reply | To 17 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson