Free Republic
Browse · Search
News/Activism
Topics · Post Article


1 posted on 08/27/2010 5:19:19 PM PDT by neverdem
[ Post Reply | Private Reply | View Replies ]


To: neverdem
a new battery-like device that could one day power small portable devices like mobile phones or laptops.

I wish I had a dollar for every time I've read that in an article.

2 posted on 08/27/2010 5:23:13 PM PDT by Moonman62 (Politicians exist to break windows so they may spend other people's money to fix them.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: El Gato; Ernest_at_the_Beach; Robert A. Cook, PE; lepton; LadyDoc; jb6; tiamat; PGalt; Dianna; ...
Reanimated ‘Junk’ DNA Is Found to Cause Disease

Risks: A Warning on Asthma and Acetaminophen

Strip Mines into Elk Habitat

Digital Devices Deprive Brain of Needed Downtime

FReepmail me if you want on or off my health and science ping list.

5 posted on 08/27/2010 6:23:24 PM PDT by neverdem (Xin loi minh oi)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: neverdem; SunkenCiv
On the other hand, the production of protons and electrons from complete oxidation of glucose potentially encompasses a lengthy biochemical chain which possibly may be implemented using sets of immobilized enzymes in the manner of mitochondrial respiration. (Mitochondrial power density is 0.1 - 1 MW/m3.)

http://www.nanomedicine.com/NMI/6.3.4.5.htm
The problem is that you can not scale it up to sufficient volumes.

The next problem relates to engineering: How is the packaging to be done, this article is a good introduction http://www.northeastern.edu/bionano/bio-pdfs/J%20N%20N%20%20%20%20Bio%20Fuel%20Cells%20and%20Bio%20Batteries.pdf

6 posted on 08/28/2010 3:24:52 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson