Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Iran's navy offers to escort Gaza ships
MSLSD via Twitter/Breaking News ^ | 6-6-10 | Reuters

Posted on 06/06/2010 8:25:58 AM PDT by pillut48

Official: Elite Revolutionary Guards are prepared to intervene

TEHRAN - Iran's elite Revolutionary Guards are ready to provide a military escort to cargo ships trying to break Israel's blockade of Gaza, a representative of Supreme Leader Ayatollah Ali Khamenei said on Sunday.

"Iran's Revolutionary Guards naval forces are fully prepared to escort the peace and freedom convoys to Gaza with all their powers and capabilities," Ali Shirazi, Khamenei's representative inside the Revolutionary Guards, was quoted as saying by the semi-official Mehr news agency.

Any intervention by the Iranian military would be considered highly provocative by Israel which accuses Iran of supplying weapons to Hamas, the Islamist movement which rules Gaza.

(Excerpt) Read more at msnbc.msn.com ...


TOPICS: Crime/Corruption; Culture/Society; Foreign Affairs; News/Current Events
KEYWORDS: gaza; globaljihad; iran; iraniannavy; israel; republicanguard; spartansixdelta; terrorflotilla; terrorflotillas
Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-79 next last
To: pillut48
The Iranian navy (according to FAS) is small, weak, and old. 1970 to 80's vintage and under 1000 tons, mostly.

I wonder how "elite" their navy commanders are - they must know it's a suicide mission. If ordered to go, I give even money they won't even make it to Suez without breaking down or sinking. If they make it through to guard the flotilla, they're up against modern weapons with no air cover. IOW, their job is to die on camera.

41 posted on 06/06/2010 11:17:30 AM PDT by ZOOKER ( Exploring the fine line between cynicism and outright depression)
[ Post Reply | Private Reply | To 1 | View Replies]

To: ZOOKER; pillut48
The Iranian navy (according to FAS) is small, weak, and old. 1970 to 80's vintage and under 1000 tons, mostly.

Unless they have secretly acquired (or "borrowed") one or two of the newer generation diesel-electric submarines. If one of those were to loiter along undetected near a convoy and sink an Israeli warship, similar to what recently occurred in Korea, that would be a game changer.

42 posted on 06/06/2010 11:43:05 AM PDT by tarheelswamprat
[ Post Reply | Private Reply | To 41 | View Replies]

To: billhilly
"Methinks Iran wants to get rid of it’s Navy."

I love how you think.... SUPERIOR ATTITUDE, SUPERIOR STATE OF MIND!

Prayers for the best outcome for Israel - cools heads, but "aim small, miss small" :-)

43 posted on 06/06/2010 12:25:59 PM PDT by NordP (COMMON SENSE CONSERVATIVES - Love of Country, Less Govt, Stop Spending, No Govt Run Health Care!!!)
[ Post Reply | Private Reply | To 35 | View Replies]

To: hennie pennie; All; Spunky; ~Kim4VRWC's~; 1035rep; 2ndDivisionVet; 4woodenboats; 5Madman2; ...

Not yet.

The latest (unrelated) is a two mile or so incursion into Iraqi Kurdistan by Islamic Iranian troops with armored vehicles and a tank after shelling of Peshmarga positions from within Iran for the past week at this location.

The Obama administration may well be ENCOURAGING Iran to provoke a confrontation to goad Israel into a response attack, which would trigger Hamas and Hezbollah attacks on Israel with missiles in retaliation and THEN all hell will break loose for the street level thug Obama, unable to see beyond his desire to destroy us, as some 50,000 + suiciders/homiciders ALREADY inside the USA and thousands more aimed at US targets worldwide in a frenzy of soft targetting attacks in many other nations come into action.

IMHO Obama will delight in the destruction he unleashes on America and American interests, which is far too focused to be pure ignorance. Just as the lackadaisical, casual Gulf oil spill handling and thus an excuse for a drilling ban SERVES TO BOOST THE VALUE of Brazilian offshore investment held by his master Soros. And protects Saudi oil sales to the USA, While increasingly the sales are siphoned off to an oil hungry China, thus starving us.

And making Brazilian oil even more viable.

Plus the deep sea BP oil reservoir is aparentlhy the second biggest reserve in the world and shutting it down and any other access to it a plus for Soros and Brazil.

The fact that the BP CEO (or President) sold well over a $1 million of his stock ONE WEEK BEFORE the explosion does lead to less than a tin foil conspiracy possibility that this was a planned event between BP and Obama to support the motives outlined above.

With any administration, even weird Carter or unscrupulous Clinton, except the Oba-Hussein Thugocracy I would shun such a comment as tinfoil hat level. Here, as I watch our nation being destroyed - IMHO on purpose - this appears too plausible to avoid sharing.


44 posted on 06/06/2010 12:52:03 PM PDT by FARS (wmd)
[ Post Reply | Private Reply | To 20 | View Replies]

To: FARS
The Obama administration may well be ENCOURAGING Iran to provoke a confrontation to goad Israel into a response attack, which would trigger Hamas and Hezbollah attacks on Israel with missiles in retaliation and THEN all hell will break loose for the street level thug Obama, unable to see beyond his desire to destroy us, as some 50,000 + suiciders/homiciders ALREADY inside the USA and thousands more aimed at US targets worldwide in a frenzy of soft targetting attacks in many other nations come into action.

If by 'encouraging' you are saying that Iran smells weakness in the 0bama administration - then I think you may be partially correct. I cannot imagine in my worst nightmares that 0bama would otherwise encourage all hell breaking loose, nor can I see all the people in the bureaucracy not catching wind of this and exposing such an overt and deliberate destruction of the country by its president.

45 posted on 06/06/2010 12:57:58 PM PDT by Godzilla (3-7-77)
[ Post Reply | Private Reply | To 44 | View Replies]

To: FARS

I like the way you think, FARS!

Wake Up America!


46 posted on 06/06/2010 1:05:02 PM PDT by blackie (Be Well~Be Armed~Be Safe~Molon Labe!)
[ Post Reply | Private Reply | To 44 | View Replies]

To: pillut48

This is a competition for the “Arab Street” Today Turkey, with post-Ottoman Empire ambition, is making a move and Iran is not accepting to be left in the back seat.

Iran does not have any navy capability so this is just rhetoric. However, it will be a highly unstable position, this means that something unexpected can happen.


47 posted on 06/06/2010 1:09:12 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: FARS

SO he try start Chicago street war with everybody involved in Middle east very Chicago thuggary for this President that normal behavior


48 posted on 06/06/2010 1:14:23 PM PDT by SevenofNine ("We are Freepers, all your media belong to us ,resistance is futile")
[ Post Reply | Private Reply | To 44 | View Replies]

To: Star Traveler

INDEED.

THX THX.

It was one of the shows our whole family watched . . . as was WAGON TRAIN.

I think those were the only two.

Maybe your link connects to the comedy spoof. I don’t recall if I’ve seen that one, or not.


49 posted on 06/06/2010 2:00:52 PM PDT by Quix (THE PLAN of the Bosses: http://www.freerepublic.com/focus/religion/2519352/posts?page=2#2)
[ Post Reply | Private Reply | To 39 | View Replies]

To: FARS

WELL PUT.

THX.


50 posted on 06/06/2010 2:02:07 PM PDT by Quix (THE PLAN of the Bosses: http://www.freerepublic.com/focus/religion/2519352/posts?page=2#2)
[ Post Reply | Private Reply | To 44 | View Replies]

To: FARS

Thanks FARS.
http://www.freerepublic.com/focus/news/2528860/posts


51 posted on 06/06/2010 2:21:57 PM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 44 | View Replies]

To: FARS
IMHO Obama will delight in the destruction he unleashes on America and American interests, which is far too focused to be pure ignorance.

I agree, He is not the interfering ruler of Sun Tzu, he is the enemy within. It is terrifying that so few people see his true purpose shown through his actions and still believe the platitudes dribbling from his lips.

52 posted on 06/06/2010 2:49:29 PM PDT by Pan_Yan
[ Post Reply | Private Reply | To 44 | View Replies]

To: davidosborne

bump


53 posted on 06/06/2010 10:12:31 PM PDT by Sun (Pray that God sends us good leaders. Please say a prayer now.)
[ Post Reply | Private Reply | To 30 | View Replies]

To: FARS; WestCoastGal; Velveeta; DelaWhere; milford421; PGalt; Rushmore Rocks

Thanks for sharing your knowledge.


54 posted on 06/07/2010 1:44:00 AM PDT by nw_arizona_granny ( garden/survival/cooking/storage- http://www.freerepublic.com/focus/chat/2299939/posts?page=5555)
[ Post Reply | Private Reply | To 44 | View Replies]

To: FARS

Thanks for the ping!


55 posted on 06/07/2010 6:12:46 AM PDT by Alamo-Girl
[ Post Reply | Private Reply | To 44 | View Replies]

To: pillut48
Blockade running and attempting to break blockades are acts of war.

Does Ahmahdinutjob really want to go there?

56 posted on 06/07/2010 6:15:21 AM PDT by ArrogantBustard (Western Civilization is Aborting, Buggering, and Contracepting itself out of existence.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: ArrogantBustard

In a word, Yes.

Remember, the Gog and Magog war is started by a coalition of Arab nations led by Turkey and Iran. I don’t know if this is the war that results in the destruction of Damascas, but I do know that we’re looking at the beginning of the End of Days.


57 posted on 06/07/2010 6:29:45 AM PDT by paladin1_dcs
[ Post Reply | Private Reply | To 56 | View Replies]

To: paladin1_dcs

I don’t agree with Evangelical Protestant eschatology.

But you may be right about Nutjob wanting to “go there” ...


58 posted on 06/07/2010 6:31:39 AM PDT by ArrogantBustard (Western Civilization is Aborting, Buggering, and Contracepting itself out of existence.)
[ Post Reply | Private Reply | To 57 | View Replies]

To: ArrogantBustard

Umm, that’s not Evangelical Protestant eschatology.

The events outlined in Eze. 38 have not come to pass yet, even the Jews are still looking for it to happen, so it’s not something that only one small portion of a branch of Christianity is expecting. This is a major prophecy that concerns Jews and Christians, of all stripes, equally.


59 posted on 06/07/2010 6:57:31 AM PDT by paladin1_dcs
[ Post Reply | Private Reply | To 58 | View Replies]

To: pillut48

>>TEHRAN - Iran’s elite Revolutionary Guards are ready to provide a military escort to cargo ships trying to break Israel’s blockade of Gaza...<<

I have a hard time believing they’ll actually do it. If this doesn’t lead to Ezekiel 39 war, nothing will.


60 posted on 06/07/2010 7:18:58 AM PDT by RobRoy (The US Today: Revelation 18:4)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-79 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson