all of Behe and Demskis arguments have failed? How so? You’ve doen nothign to show that macroevolution is even remotely possible, and htey’ve given some VERY serious probability limits that put the kaboshes to the idea totally- As well, the mathematical improbabilities calculated by the Wistar scientists make the idea of Macroevolution an impossiblity- Simply insinuating htat it isn’t entirely impossible, that a slight chance so miniscule as to be almost nill means the trillions of positive mutaitons needed for Macroevolution simply isn’t a rational feasbility.
[[The math is probably accurate depending on the size of the genes being calculated but it has nothing to do with reality or biology. It is based on irrelevant assumptions.]]
Irrelevent assumptions? please do explain. The fact is that these calculations are not just based on the necessity of one or several or even a few hundred positive mutations being produced, it’s based on the fact that the myriad of system changes that number in the trillions would neeed just as many positive and ever increasingly complex mutations in order for Macro to be aeven a slgiht possibility. The fact is that in al lthe years of study, practically every mutation seen has been either deleterious or neutral with only a VERY few having a benign unintended immediate positive effect, but the mutations htemselves are still deleteriosu and add to increased deaths. If we’re goign to talk about irrelevent assumptions, then we’re goign to have to include the assumptions that the process of Macroevolution solely rely on because wwe have nothign but assumptions to go on
[[Mutation varies, selection directs.]]
Selection directs MICROEvolution- there is no proof that it directed Macroevolution- none- there are only assumptions that it must have
[[No genes were produced by random chance. No evolutionary biologist claims they were. This by itself debunks this ‘proof’.]
That doesn’t disprove their calculations at all- of course the genes had to be produced by random chance- A mutation is a random mistake regardless of the selective pressures.
[[If evolution had to start with E. coli, and could not rely on the determinism of chemistry, the guidance of selection, and the tendency of simple processes passed through multiple iterations to result in complex structures, then he might have a point. However, that isn’t the case, life began from much simpler molecules and through the process of imperfect replication (just as happens now in DNA/RNA) filtered through selection (just as happens today) and through multiple iterations of those two, has developed complexity.]
Order from chaos does nothign to explain the intense complexities of even the ‘simplest’ life forms- the only examples of order from chaos given are VERY simplistic examples, and to suggest that the immense intelligently designed features of the myriad of species we have today came from ordered chaos of the most simplistic means is askign that we suspend knowledge and rely solely on faith that something that had only a 10 to the 300’th or so power chance of ever happening just once is beyond a reasonable request.
[[Don’t be impressed with big numbers (or extremely tiny ones either) without first understanding the relevance of those numbers to observations.]
The relevence is backed up by the complete lack of both scientific evidence and fossil records, not to mention current and past test investigations- so I thank you kindly, but I’ll stick with the much more reasonable ‘big numbers’ and leave faith out of the discussion.
[[Now, could you please tell me where to find this number 10350 you just threw out.]
You’re right- I did throw it out as anythign above 10 to a much lower power is really irrelevent anyways- The societies needed to sustain such chance occurences and continue on in an ever progressingly complex upward Macroevoltion are completely absent from the fossil records, and as the scientists showed, it would have meant that the first colnies had to be inches deep- coverign hte whole earth and needing billions of years just to advance to the next step IF Macroevolution were even a possibility-
We can shaow all the simpler ‘orders from chaos’ examples we like- but these examples do nothign to shore up the complexities and intellgiently designed compelxities we see in actual biology.
Yes. If you would bother reading the work done by scientists who work in the fields referenced by Dembski and Behe, including mathematicians and biologists who understand the theory and the practical consequences of Dembski and Behe's work as well as Dembski and Behe do, you would not be asking that question. Dembski's CSI and Behe's IC have been debunked multiple times. Each time Dembski comes up with some putative correction to his hypotheses, numerous mathematicians point out the flaws in the assumptions and numerous biologists point out the flaws in his understanding of biolgy. Every time Behe comes up with a supposed Irreducibly Complex system (which is really inapplicable the way it is normally defined) a number of scientists show that the system can evolve.
Behe's Irreducible Complexity is irrelevant because it deals exclusively with how to break something not how to not build something. Many systems can be assembled piece by piece, using scaffolding and co-option of function, that will break if a subsystem is removed. To make an analogy, IC claims that if you can remove a single block from a structure built of a child's building block set and have the entire structure collapse, the structure could not possibly have been built. That isn't the same as showing that a specific building block could not be positioned in a specific place with a range of functions. If you want evidence of the ability of biological systems to change function look up the precursor to hemoglobin.
"As well, the mathematical improbabilities calculated by the Wistar scientists make the idea of Macroevolution an impossiblity-"
In my last post I took three of those calculations, or rather the results of those calculations, the calculations themselves were not shown on the page I read, and I showed why those calculations were invalid. If you want me to debunk one of their calculations then give me a single instance, don't expect me to go through their entire set of publications and debunk each and every one. It is very easy for you to sit there and point me to a pile of documents but so much more difficult for me to slog through them all. You go through as many as you want, pick one, present it here and I'll do what I can to address it.
"Irrelevent assumptions? please do explain. The fact is that these calculations are not just based on the necessity of one or several or even a few hundred positive mutations being produced, it’s based on the fact that the myriad of system changes that number in the trillions would neeed just as many positive and ever increasingly complex mutations in order for Macro to be aeven a slgiht possibility."
The calculation I addressed was very specific. It calculated the probability of two specific genes placed in a specific order in E.coli. The assumption is that the two E.coli genes would have to occur in the order they are in, in the exact form they currently have, randomly and spontaneously. That type of calculation assumes that the presence of each nucleotide is independent of every other and is usually nothing more than the number of bases (4) to the power of the number of positions (x). If we assume, for argument's sake, that x=100 then the probability of an ordered string with an alphabet of 4 of length 100 would be .622x10-61.
However if we lose the requirement for the two genes to be in some specific sequence*, lose the requirement that the two genes appear suddenly rather than be a modification of pre-existing sequences*, add in the enormous number of different types of genetic modification*, add in affects of selection* and fixation* and the entire calculation becomes a waste of time and completely useless. The calculation simply does not reflect reality.
*As has been observed.
"The fact is that in al lthe years of study, practically every mutation seen has been either deleterious or neutral with only a VERY few having a benign unintended immediate positive effect, but the mutations htemselves are still deleteriosu and add to increased deaths"
You have, in your body ~100 mutations your parents do not have. There are 6 billion people in the world (and this doesn't include all those with immediately deleterious mutations resulting in death), far more than has ever lived before. Even if we assume that all of those mutations are single nucleotide changes that do not result in a changed reading frame, that means there is potentially 600 billion mutations in the population. Assuming that mutations at all positions in the genome have equal probability and that 1/3 of them will occur on the third base in a codon (which doesn't change the amino acid) that leaves 200 billion mutations. Our genome is 3 billion long, with only 2 billion affecting the amino acid.
How many of the population of 6 billion will live beyond 70? How many will die of deleterious mutations?
With the capacity for every possible single nucleotide mutation in our genome to occur, where are the enormous numbers of deaths from deleterious mutations?
I notice that you still have the requirement that all mutations be immediately deleterious or beneficial. Why is that? Whether a mutation which does not immediately kill the organism, especially those which affect morphology, is deleterious of beneficial is determined by the environment. If the environment changes, then the status of applicable mutations change.
You seem to be stuck in the idea that the only way macro evolution could happen is through some radical saltation event. Something like a theropod suddenly developing wings, modified ribs, and a more efficient cardio-vascular system all in one generation. Is that what you believe?
"[[No genes were produced by random chance. No evolutionary biologist claims they were. This by itself debunks this ‘proof’.]
That doesn’t disprove their calculations at all- of course the genes had to be produced by random chance- A mutation is a random mistake regardless of the selective pressures."
Actually those calculations assume that the entire gene appears at once.
GATCTGTCTATAGTCTATGTGTAACA
The probability of the above string forming all at once is .222x10-16. This is the type of calculation you and your sources use.
Assuming only SN changes, what should be calculated is the probability of changing an existing gene into a new gene.
Original gene:
GAACTGTCTATAGACTATGTGAAACA
target gene:
GATCTGTCTATAGTCTATGTGTAACA
The probability of changing the original to the target is .111
Big difference.
Now the kicker - neither calculation tells us a damn thing about biology, they simply don't reflect reality.