Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Bush surprises Koizumi with Segway gift
NZ.com ^ | 11-16-2005

Posted on 11/16/2005 4:38:55 PM PST by Cagey

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-50 last
To: oyez

Oh. Yes:

http://www.japantimes.co.jp/cgi-bin/makeprfy.pl5?nn20011231a9.htm


http://news.bbc.co.uk/1/hi/england/2143703.stm


41 posted on 11/16/2005 5:40:22 PM PST by PoorMuttly ("He is a [sane] man who can have tragedy in his heart and comedy in his head." - G. K.Chesterton)
[ Post Reply | Private Reply | To 35 | View Replies]

To: AGTTGTATTGAAAACACTATCTCAACG
Thats like giving someone a pocket protector as a gift.

Great comment. Sure got a smile outa me. Not too shabby fer a newb. If your politics are as on as your humorous quips, we're going to get along just great.

Welcome to FReerepublic.

Nam Vet

42 posted on 11/16/2005 5:41:19 PM PST by Nam Vet (The Gaulistinians are rioting to reclaim the ancient 'holy ground' of Paris.)
[ Post Reply | Private Reply | To 11 | View Replies]

To: oyez

Maybe the Japanese can sell these Legways made of Legos:

http://perso.freelug.org/legway/LegWayLineFollow.avi
http://perso.freelug.org/legway/LegWaySpinner.avi


43 posted on 11/16/2005 5:45:20 PM PST by Right Wing Assault ("..this administration is planning a 'Right Wing Assault' on values and ideals.." - John Kerry)
[ Post Reply | Private Reply | To 35 | View Replies]

To: Cagey

44 posted on 11/16/2005 5:47:24 PM PST by ShadowDancer (I think I may have the Asian Bird Fru. I mean Flu. (Damn, it's starting already))
[ Post Reply | Private Reply | To 1 | View Replies]

To: Fido969
I'll bet it's in his DNA.

Dang it! I was gonna say that! GMTA

45 posted on 11/16/2005 5:56:44 PM PST by ItsForTheChildren
[ Post Reply | Private Reply | To 33 | View Replies]

To: SamAdams76
The mystery hype was great wasnt it?....the speculation that the genius inventor had invented a personal anti gravity transportation system was really neat...

And the secret meetings with wealthy investors of the cutting edge bent...like Steve Jobs...

I hope GW didn't torque his knee too badly when that that piece of crap went tango uniform on him.

46 posted on 11/16/2005 5:57:32 PM PST by joesnuffy
[ Post Reply | Private Reply | To 21 | View Replies]

To: Sonny M

47 posted on 11/16/2005 5:58:09 PM PST by RasterMaster ("Bin Laden shows others the road to Paradise, but never offers to go along for the ride." GWB)
[ Post Reply | Private Reply | To 18 | View Replies]

To: Xenophobic Alien
looks like 41 is trying to take the segway off-road
48 posted on 11/16/2005 5:58:54 PM PST by Battle Hymn of the Republic
[ Post Reply | Private Reply | To 15 | View Replies]

To: Xenophobic Alien

oops, I meant 43


49 posted on 11/16/2005 5:59:22 PM PST by Battle Hymn of the Republic
[ Post Reply | Private Reply | To 15 | View Replies]

Comment #50 Removed by Moderator


Navigation: use the links below to view more comments.
first previous 1-2021-4041-50 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson