Free Republic
Browse · Search
News/Activism
Topics · Post Article

To: AndrewC

Could you translate that into English and show me where to find the spread of conserved code lengths in simple chart form?


147 posted on 06/08/2004 12:47:52 PM PDT by js1138 (In a minute there is time, for decisions and revisions which a minute will reverse. J Forbes Kerry)
[ Post Reply | Private Reply | To 146 | View Replies ]


To: js1138
Go here --->http://www.ncbi.nlm.nih.gov/BLAST/

Click on the type of query you would like to do. Then put in the sequence you would like to check. After the process is completed, a listing of matches found in the searched databases will be given to you. In that data is a number describing the probability of finding a random sequence in the database. Here is one for a 300 base string.

The probability is 10-167 with 0 mutations.

>gi|5729841|ref|NM_006708.1|  LocusLink infoUniGene infoGeo Homo sapiens glyoxalase I (GLO1), mRNA
          Length = 1993

 Score =  595 bits (300), Expect = e-167
 Identities = 300/300 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   ctagttaaggcggcacagggccgaggcgtagtgtgggtgactcctccgttccttgggtcc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ctagttaaggcggcacagggccgaggcgtagtgtgggtgactcctccgttccttgggtcc 60

                                                                       
Query: 61  cgtcgtctgtgatactgcagttcagccatggcagaaccgcagcccccgtccggcggcctc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  cgtcgtctgtgatactgcagttcagccatggcagaaccgcagcccccgtccggcggcctc 120

                                                                       
Query: 121 acggacgaggccgccctcagttgctgctccgacgcggaccccagtaccaaggattttcta 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 acggacgaggccgccctcagttgctgctccgacgcggaccccagtaccaaggattttcta 180

                                                                       
Query: 181 ttgcagcagaccatgctacgagtgaaggatcctaagaagtcactggatttttatactaga 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 ttgcagcagaccatgctacgagtgaaggatcctaagaagtcactggatttttatactaga 240

                                                                       
Query: 241 gttcttggaatgacgctaatccaaaaatgtgattttcccattatgaagttttcactctac 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 gttcttggaatgacgctaatccaaaaatgtgattttcccattatgaagttttcactctac 300

Here is the result for the mouse compared to human. 10-26 with 27 mutations.

>gi|26327652|dbj|AK031832.1|  LocusLink infoUniGene infoGeo Mus musculus adult male medulla oblongata cDNA, RIKEN full-length
           enriched library, clone:6330414G20 product:GLYOXALASE I
           homolog [Homo sapiens], full insert sequence
          Length = 959

 Score =  127 bits (64), Expect = 1e-26
 Identities = 145/172 (84%)
 Strand = Plus / Plus

                                                                       
Query: 83  cagccatggcagaaccgcagcccccgtccggcggcctcacggacgaggccgccctcagtt 142
           ||||||||||||| || |||||  ||||| | |||||||| || ||| ||||  |||| |
Sbjct: 46  cagccatggcagagccacagccggcgtccagtggcctcactgatgagaccgctttcagct 105

                                                                       
Query: 143 gctgctccgacgcggaccccagtaccaaggattttctattgcagcagaccatgctacgag 202
           ||||||||||  | ||||| || ||||||||||||||| ||||||| || |||||| || 
Sbjct: 106 gctgctccgatccagaccctagcaccaaggattttctactgcagcaaacgatgctaagaa 165

                                                               
Query: 203 tgaaggatcctaagaagtcactggatttttatactagagttcttggaatgac 254
           | ||||||||||||||||| |||||||||||||| || ||||||||| ||||
Sbjct: 166 ttaaggatcctaagaagtccctggatttttatacgagggttcttggactgac 217

148 posted on 06/08/2004 1:01:33 PM PDT by AndrewC (I am a Bertrand Russell agnostic, even an atheist.</sarcasm>)
[ Post Reply | Private Reply | To 147 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson