Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Update from Ukraine | Did Ukraine lost the NATO deal | One more Ruzzian General is lost
Youtube.com ^ | 1-12-2023 | Denys Davydov

Posted on 07/12/2023 5:58:34 PM PDT by UMCRevMom@aol.com

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-80 ... 181-184 next last
To: USA-FRANCE; cabojoe
An you spend your time talking about his clothes??

Dude should have broken out his heels from his entertainment days.

He would have been In Like Flynn.

41 posted on 07/12/2023 8:28:17 PM PDT by kiryandil (China Joe and Paycheck Hunter - the Chink in America's defenses)
[ Post Reply | Private Reply | To 38 | View Replies]

To: redfreedom

the intentional misspelling is actually a bonus - you can just ignore since you know what quality of thought and attempted objectivity to expect. of course, we actually at this point recognize the usual suspects daily threads anyway.

off-topic, but I have seen news items over the last few years suggesting that there are significant funds and efforts involved at penetrating and diverting discussion/topics on various online forums. I have wondered if compensation is ever tied to ‘engagement’ e.g. for example replies in a thread posted.


42 posted on 07/12/2023 8:34:41 PM PDT by WoofDog123
[ Post Reply | Private Reply | To 18 | View Replies]

To: ransomnote; tennmountainman

Apparently you both missed Comment #4. His SPEECH/VIDEO is also available. Perhaps, it would help if you cross-reference you sources. Anyway, alls well that ends well :)


43 posted on 07/12/2023 8:35:03 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion)
[ Post Reply | Private Reply | To 33 | View Replies]

To: USA-FRANCE

“An you spend your time talking about his clothes??”

You are exactly correct. Expansion of some thoughts would increase understanding. President Zelenskyy does not suffer from their snide remarks. Their attempts to ridicule assassination usually backfire upon themselves for all to witness.


44 posted on 07/12/2023 8:40:53 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion)
[ Post Reply | Private Reply | To 38 | View Replies]

To: USA-FRANCE

Well said. And all too true


45 posted on 07/12/2023 8:42:15 PM PDT by Nifster ( I see puppy dogs in the clouds )
[ Post Reply | Private Reply | To 36 | View Replies]

To: UMCRevMom@aol.com

Thank you for your updates. My Ukrainian friends and I appreciate it


46 posted on 07/12/2023 8:44:04 PM PDT by Nifster ( I see puppy dogs in the clouds )
[ Post Reply | Private Reply | To 1 | View Replies]

To: USA-FRANCE

“Putin, with his completely insane act of imperialistic piratery of Ukraine’s resources, has transformed the common swedish citizens psych down to the core!

The swedes gave up 200 years of neutrality because of Putin’s folly. They understood, that neutrality in this Ukraina war has indirectly become a russian weapon.”

Your comment provided great content.
Hopefully, your wisdom won’t fall of deaf ears.


47 posted on 07/12/2023 8:49:54 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion)
[ Post Reply | Private Reply | To 36 | View Replies]

To: WoofDog123

“we actually at this point recognize the usual suspects”

So true. Yet, we will always hold out hope for them to amend their silly remarks. :)


48 posted on 07/12/2023 8:52:14 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion)
[ Post Reply | Private Reply | To 42 | View Replies]

To: UMCRevMom@aol.com

VIDEOS

1. ‘We Wanted to Scare Ukrainians With the Dam but It Went the Wrong Way’ – #intercepted calls
UATV English
395K subscribers
https://www.youtube.com/watch?v=wi6Ru-xZv14

2. Meat Grinder ‘a la russe.’ Professional Burnout Gripped russian Soldiers
UATV English
395K subscribers #intercepted #ukrainewar
‘Anyway, you’re gonna die’ – this old russian war doctrine is destroying russian army with the same effectiveness as ‘Storm Shadow’ has. #intercepted calls reveal the russian ‘effective management of the front line regiments.’
https://www.youtube.com/watch?v=1NIVID4fRP4


49 posted on 07/12/2023 8:55:46 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion)
[ Post Reply | Private Reply | To 48 | View Replies]

To: UMCRevMom@aol.com
A LITTLE CHUCKLE :)
50 posted on 07/12/2023 8:57:51 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion)
[ Post Reply | Private Reply | To 49 | View Replies]

To: Widget Jr
Ukraine's offensive is moving slow.

No close air support so Ukraine have to concentrate on eliminating the Russian logistics and artillery. Compare these two:

Cluster munition will compensate CAS somewhat as it can clear mine fields and Russian positions.

51 posted on 07/12/2023 8:59:56 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 27 | View Replies]

To: Widget Jr; UMCRevMom@aol.com

How to operate a steel plant during war

https://metinvestholding.com/en/media/news/dodalasya-specifka-vonnogo-chasu-velike-ntervyu-oleksandra-mironenka-coo-grupi-metnvest-nv-ua-pro-rozumnu-avtonomyu-zavodv-perspektivi-marupolya-ta-zmni-v-logstic


52 posted on 07/12/2023 9:05:01 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 27 | View Replies]

To: buwaya; ganeemead

I think the wartime wardrobe and his obvious working out are genius for public relations imagery and for his leadership image during the war.


53 posted on 07/12/2023 9:11:02 PM PDT by ansel12 (NATO warrior under Reagan, and RA under Nixon, bemoaning the pro-Russians from Vietnam to Ukraine.)
[ Post Reply | Private Reply | To 31 | View Replies]

To: AdmSmith

“How to operate a steel plant during war”

Thank you for the article. So many incredible things are happening simultaneously!


54 posted on 07/12/2023 9:13:19 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion)
[ Post Reply | Private Reply | To 52 | View Replies]

To: Nifster

“Thank you for your updates.”

You are more than welcome. I believe it is important to keep information current. Please feel free to add your sources to forum as well :)


55 posted on 07/12/2023 9:15:46 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion)
[ Post Reply | Private Reply | To 46 | View Replies]

To: ansel12

“I think the wartime wardrobe and his obvious working out are genius for public relations imagery and for his leadership image during the war.”

Never thought about it before, but TOTALLY agree!


56 posted on 07/12/2023 9:19:44 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion)
[ Post Reply | Private Reply | To 53 | View Replies]

To: Nifster; All

Digital Gulag and FSB databases: Russian special services collect data on Russians | Special Report
UATV English
395K subscribers
https://www.youtube.com/watch?v=IzUhPzEVGlc&list=PLjbexoFhnuNp8x8mFopvOGiTR9mu2hSul

The FSB and Roskomnadzor spy on regime dissenters, regime evaders, and anti-war activists. Kremlin agents have not limited themselves to surveillance and phone tapping. They harass dissidents, hack their social networks and emails, and collect personal information and use it in court.

All of this is thanks to the Russian authorities, who have legally allowed the storage and processing of personal data of Russians under the pretext of fighting extremism and terrorism. How the Kremlin’s surveillance systems work and whether there are ways to hide from it - find out in a special report by Ksenia Barvinenko.


57 posted on 07/12/2023 9:35:10 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion)
[ Post Reply | Private Reply | To 56 | View Replies]

To: UMCRevMom@aol.com

I’m convinced that it was a wise choice to symbolize and show awareness of what his troops are enduring and a very effective and even comforting choice for his people who are displaying so much courage, it reflects a national image of resolve and resistance.

To me, the olive drab functional clothing is a bonding image of national unity and purpose, worn for the duration.


58 posted on 07/12/2023 9:35:21 PM PDT by ansel12 (NATO warrior under Reagan, and RA under Nixon, bemoaning the pro-Russians from Vietnam to Ukraine.)
[ Post Reply | Private Reply | To 56 | View Replies]

To: AdmSmith; AmericanInTokyo; amnestynone; Apparatchik; AZJeep; babble-on; TheBattman; BeauBo; bert; ..

VIDEO WITH SUMMARIZED COMMENTARY
12 Jul: FOOTAGE: Ukrainians WREAK HAVOC ON THE RUSSIAN DEFENSES | War in Ukraine Explained

Reporting from Ukraine
https://www.youtube.com/watch?v=_NfxJmm8GPk

⚠️ Watch RFU in 18+ languages: https://www.youtube.com/@RFU/channels

I am Ukrainian. My country has been invaded by Russia. In this video I will tell you what happened on the five hundred fourth day of the war.

Day 504: Jul 12

Today the biggest news comes from the south.

Here, Ukrainian forces continue exploiting Russian rigidities by conducting an effective war of attrition, and it is finally bringing major results. Last time I told you that a Russian soldier said in an interview that right now, Ukrainians are focused on draining accumulated Russian ammunition, equipment, and reserves.

One of the tactics that Ukrainians use is to trigger Russian artillery with small assaults, track them down with reconnaissance drones, and destroy them by conducting HIMARS strikes. It seems like this proved to be an extremely effective tactic because, over the last week, based only on the available footage, Ukrainians destroyed more than 20 artillery and air defense systems only in the Orikhiv direction.

A recent video shows how Ukrainians identified and destroyed two artillery systems Uragan, together with the trucks that delivered them ammunition. Uragan is one of the best Russian artillery systems that uses much bigger caliber shells and has a range almost twice of Grad systems.

The video shows how the first rocket destroyed a truck with equipment, and less than 2 seconds later, another rocket hit Uragan itself. The same day, Ukrainians spotted another Uragan in a tree line – they immediately targeted the ammunition depot and the Uragan system, causing it to detonate.

Ukrainian fighters from the 44th Artillery Brigade published a video showing how they hunted down several more artillery systems a few days prior. Ukrainian drone operator noticed the movement of a Grad system, waited until it got to the shelter, and then gave the coordinates for the strike.

The same day he found another artillery system Msta-S, awkwardly hiding in a tree line. Lastly, closer to the night, another artillery position was revealed – this time, it was the position of Gitsint-B. The site rapidly caught on fire, as the ammunition storage nearby also got hit.

Russian forces published a video of the aftermath of a HIMARS strike on Giatsint-B. Russian soldiers said that the artillery system basically evaporated, leaving just a crater where it was stationed. Around 25 meters away, they found the gun of the artillery system that got stuck in the ground.

There are many more videos of other successful HIMARS strikes on Russian artillery systems, and all of this means one thing – the ability of the Russians to provide artillery support and conduct counterbattery fire rapidly decreases. Ukrainians took advantage of that, especially the lack of counterbattery fire, and brought their own Grad systems closer to the front to fire at Russian trenches and fortifications.

Ukrainians also know that Russian commanders are not allowed to make rotations, and those troops who stay on the zero line, stay there till the end. Such conditions are detrimental to the morale of the soldiers, who know that they will not be replaced, that the flying above them HIMARS rockets are about to destroy more Russian artillery systems, leaving them with even less support, and that sooner or later they will die from Ukrainian artillery.

The commander of the Russian 58th Combined-Arms Army, Major General Ivan Popov, who is basically responsible for the hottest front, wanted to break the bureaucratic machine of the Russian Ministry of Defense and solve these problems once and for all. He got fired by the Chief of the Russian General Staff, Gerasimov, the same day. Popov was shocked and recorded an audio message to explain what happened.

He said that during the meeting with the High Commanders, instead of bringing to the table yet another positive report, he said that his troops are in need of rotation after fighting in combat for a long time and suffering significant casualties and that Russian counterbattery fire is horrible and virtually nonexistent, which is why Ukrainians are gradually getting an edge. When his concerns were dismissed, Popov threatened to appeal to Russian President Vladimir Putin with his complaint. Gerasimov accused Popov of alarmism and blackmail and fired him on the spot.

The Russian Ministry of Defense did not like Popov from the beginning because he was breaking a lot of rules and acted without the permission of the General Staff. For example, he created and supplied himself the first Russian drone detachments in the Zaporizhia region.

*** Select the 3 horizontal dots to view the Complete Transcript [Below video/ top right corner]


59 posted on 07/12/2023 10:29:09 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion)
[ Post Reply | Private Reply | To 58 | View Replies]

To: buwaya

It actually IS possible to be an engineer without looking like a bum...


60 posted on 07/12/2023 10:34:35 PM PDT by ganeemead (Ukraine/Zelensky: Adding an element of chutzpah to ordinary Nazism...)
[ Post Reply | Private Reply | To 31 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-80 ... 181-184 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson