Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Researchers fear mysterious polio-like illness may spread in US
nypost.com ^ | 12/27/18 | Noah Bressner

Posted on 12/28/2018 9:08:55 AM PST by Tilted Irish Kilt

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-35 last
To: Tilted Irish Kilt

Many diseases can be followed by the school calendar.


21 posted on 12/28/2018 9:55:53 AM PST by bgill (CDC site, "We don't know. how people are infected with Ebola.")
[ Post Reply | Private Reply | To 10 | View Replies]

To: IronJack

You left out homelessness.


22 posted on 12/28/2018 10:11:57 AM PST by Jeff Chandler (Every time a lefty cries "racism", a Trump voter gets his wings.)
[ Post Reply | Private Reply | To 5 | View Replies]

To: bgill
Many diseases can be followed by the school calendar.

An increase in the prevalence of lice seems to increase after long school holidays when children spend time at home in Mexico.

23 posted on 12/28/2018 10:14:14 AM PST by Jeff Chandler (Every time a lefty cries "racism", a Trump voter gets his wings.)
[ Post Reply | Private Reply | To 21 | View Replies]

To: Tilted Irish Kilt

Annother benefit bestowed by our southern immigrant saviours.


24 posted on 12/28/2018 10:40:55 AM PST by arthurus (vlh)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tilted Irish Kilt

Gee, I wonder why the CDC hasn’t examined the incidence of this disease over time to determine where it originated...


25 posted on 12/28/2018 11:18:51 AM PST by Chewbarkah
[ Post Reply | Private Reply | To 1 | View Replies]

To: upchuck

I stopped taking the multi state flu vaccine after getting bronchitis for the 1st time, twice in one season. Been good ever since.


26 posted on 12/28/2018 11:35:16 AM PST by Harpotoo (Being a socialist is a lot easier than having to WORK like the rest of US:-))
[ Post Reply | Private Reply | To 7 | View Replies]

To: Tilted Irish Kilt

Like the 2nd Honduran boy who died of flu.


27 posted on 12/28/2018 2:19:46 PM PST by RideForever
[ Post Reply | Private Reply | To 1 | View Replies]

To: Harpotoo

Pretty much off topic, but...

I have never had a flu shot. About 5 or 6 years ago I started taking a 5000 iu pill of Vit D3 each day. Haven’t been sick yet. Yes, it could be chance. But the results, what ever the cause, are what counts for me.


28 posted on 12/28/2018 2:35:00 PM PST by upchuck (Liberalism is a foul and nasty mental disease for which the suffers should seek professional help.)
[ Post Reply | Private Reply | To 26 | View Replies]

To: RideForever
RideForever :" Like the 2nd Honduran boy who died of flu. "

Exactly true !
It will take a couple of weeks to determine exactly which influenza was involved.
Right now, it is the generic 'influenza'.

29 posted on 12/28/2018 5:12:13 PM PST by Tilted Irish Kilt
[ Post Reply | Private Reply | To 27 | View Replies]

To: Tilted Irish Kilt
Did a quick search on "Non-polio entero virus A68 and A71

A71 - First identified in the United States in 1969, enterovirus A71 (EV-A71) is one of more than 100 non-polio enteroviruses. Worldwide, EV-A71 is a common cause of hand, foot, and mouth disease in infants and young children.

A^* - Also causes respiratory illnesses (similar to the two kids who died?) This virus isn't new. Experts first identified it in 1962. In the decades since then, it only seemed to impact a very small number of people. That changed in 2014, when the CDC reported a national outbreak.

Seems like maybe the influx of illegals may be the most likely source......

30 posted on 12/29/2018 2:38:48 AM PST by trebb (Those who don't donate anything tend to be empty gasbags...no-value-added types)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tilted Irish Kilt

Thanks for posting, TIK. This is dreadful.


31 posted on 12/29/2018 7:06:18 AM PST by trisham (Zen is not easy. It takes effort to attain nothingness. And then what do you have? Bupkis.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith; AnonymousConservative; Arthur Wildfire! March; Berosus; Bockscar; cardinal4; ColdOne; ...
Thanks Tilted Irish Kilt.

32 posted on 12/31/2018 12:46:39 PM PST by SunkenCiv (and btw -- https://www.gofundme.com/for-rotator-cuff-repair-surgery)
[ Post Reply | Private Reply | View Replies]

To: Tilted Irish Kilt

Most patients had onset of AFM between August and October, with increases in AFM cases every two years since 2014. At this same time of year, many viruses commonly circulate, including enteroviruses, and will be temporally associated with AFM.
https://www.cdc.gov/acute-flaccid-myelitis/about-afm.html

This indicates that the vector is an insect or an animal with population variation every second year.


33 posted on 12/31/2018 1:37:48 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10 | View Replies]

To: AdmSmith; Jim Noble
Ping to post #33
What do you think ?
34 posted on 01/01/2019 9:26:48 AM PST by Tilted Irish Kilt
[ Post Reply | Private Reply | To 33 | View Replies]

To: Tilted Irish Kilt

Well, the temporal distribution might also suggest fecal-oral spread with water as a means of distribution. Similar to polio, and other enteroviruses.

I will observe without attributing malice that the authorities are very uninterested in the role of what they call “migration” and the spread of diseases inside the US, with enterovirus D68 as exhibit one.


35 posted on 01/01/2019 9:37:16 AM PST by Jim Noble (Freedom is the freedom to say that 2+2 = 4)
[ Post Reply | Private Reply | To 34 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-35 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson