Free Republic
Browse · Search
General/Chat
Topics · Post Article


1 posted on 10/10/2014 12:51:59 PM PDT by SeekAndFind
[ Post Reply | Private Reply | View Replies ]


Navigation: use the links below to view more comments.
first previous 1-2021-25 last
To: SeekAndFind

42 posted on 10/10/2014 3:14:27 PM PDT by Travis McGee (www.EnemiesForeignAndDomestic.com)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: SeekAndFind

Finally! I get tired of seeing documentaries during Easter where historians are given air time to deny the existence of Jesus and now muslims deserve that same treatment.


44 posted on 10/10/2014 3:28:21 PM PDT by RginTN
[ Post Reply | Private Reply | To 1 | View Replies ]

To: SeekAndFind

Saving this to read later.


45 posted on 10/10/2014 3:36:33 PM PDT by Mrs. Don-o (Seriously.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: SeekAndFind; research99; Paine in the Neck; <1/1,000,000th%; JimSEA; Aliska; Dajjal
2008: Doubt about Muhammad's Existence Poses Threat to Islamic Religious Education

Muhammad Sven Kalisch is an Islamic researcher at the University of Münster. He is also the first person in Germany to hold a Chair of Islamic Religion. Kalisch’s recent public admission that he is unsure whether the Prophet Muhammad was actually a historical person has got him into hot water.

The plan to train teachers to teach Islamic religious education at German schools has suffered a major setback in recent days. The Co-ordination Council of Muslims in Germany (KRM), to which the four largest Muslim organisations in Germany belong, has discontinued its co-operation with the Centre for Religious Studies at the University of Münster, which became the first centre of its kind in Germany to offer teacher-training courses for teachers of Islamic religion.

The dispute centres around the Director of the centre, Professor Muhammad Sven Kalisch, who converted to Islam at the age of fifteen. Speaking in a radio interview, Kalisch said that following extensive research and study, he had come to what is for a Muslim a particularly controversial conclusion, namely that the Prophet may not in fact have been a historical person.

http://www.freerepublic.com/focus/f-news/2088564/posts

54 posted on 10/12/2014 3:10:06 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: SeekAndFind

They could put this rumor to rest by doing some random dna testing of goats from the middle east. :)


56 posted on 10/12/2014 3:27:43 AM PDT by catfish1957 (Everything I needed to know about Islam was written on 11 Sep 2001)
[ Post Reply | Private Reply | To 1 | View Replies ]


Navigation: use the links below to view more comments.
first previous 1-2021-25 last

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson