Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

The Genius of Computing with Light [32:20]
YouTube ^ | February 15, 2026 | Dr Ben Miles

Posted on 02/25/2026 7:20:15 AM PST by SunkenCiv

PsiQuantum are world leaders in the race to utility-scale quantum computing, but they have been shrouded in mystery for over a decade...until now. Thanks to some good fortune and incredible generosity from the PsiQuantum team I was able to get behind the scenes and see what makes their ground-breaking quantum computer 'click'. 
The Genius of Computing with Light | 32:20 
Dr Ben Miles | 2.24M subscribers | 246,872 views | February 15, 2026
The Genius of Computing with Light | 32:20 | Dr Ben Miles | 2.24M subscribers | 246,872 views | February 15, 2026 
0:00 Silicon Valley's Most Secretive Quantum Computer 
1:38 A Quantum Computer that runs on Light 
6:03 How to Create a Single Photon 
9:00 How to Build a Quantum Clock 
10:48 Ad Read 
11:54 Detecting Single Photons> 
15:00 Creating the Perfect Material 
18:19 How to do math with light 
21:45 How to Build a Scalable Quantum Computer 
24:27 Converting Space to Time 
27:25 The First Photonic Quantum Computer Demonstrator

(Excerpt) Read more at youtube.com ...


TOPICS: Business/Economy; Computers/Internet; Science
KEYWORDS: benmiles; drbenmiles; psiquantum; quantumcomputing; sunkenciv; youtube

Click here: to donate by Credit Card

Or here: to donate by PayPal

Or by mail to: Free Republic, LLC - PO Box 9771 - Fresno, CA 93794

Thank you very much and God bless you.

YouTube transcript reformatted at textformatter.ai does not follow. The existing transcript appears to be an upload from the video maker.

1 posted on 02/25/2026 7:20:15 AM PST by SunkenCiv
[ Post Reply | Private Reply | View Replies]

To: AdmSmith; AnonymousConservative; Arthur Wildfire! March; Berosus; Bockscar; BraveMan; cardinal4; ...
I have yet to see any quantum jokes on FR. Kinda disappointed, people.

2 posted on 02/25/2026 7:21:33 AM PST by SunkenCiv (TDS -- it's not just for DNC shills anymore -- oh, wait, yeah it is.)
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv

Yeah but light speed is so darned slow!


3 posted on 02/25/2026 7:21:38 AM PST by Larry Lucido (Donate! Don't just post clickbait.)
[ Post Reply | Private Reply | To 1 | View Replies]


4 posted on 02/25/2026 7:22:13 AM PST by SunkenCiv (TDS -- it's not just for DNC shills anymore -- oh, wait, yeah it is.)
[ Post Reply | Private Reply | View Replies]

To: Larry Lucido

“Tarnation, son, who’d ever need to be in such a hurry?”


5 posted on 02/25/2026 7:25:26 AM PST by SunkenCiv (TDS -- it's not just for DNC shills anymore -- oh, wait, yeah it is.)
[ Post Reply | Private Reply | To 3 | View Replies]


6 posted on 02/25/2026 7:27:36 AM PST by SunkenCiv (TDS -- it's not just for DNC shills anymore -- oh, wait, yeah it is.)
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv

An electron was pulled over by the quantum state patrol.

The officer walked up to the car and said, “do you know how fast you were going?” To which the electron responded “no, but I know where I am!”


7 posted on 02/25/2026 8:18:17 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2 | View Replies]

To: SunkenCiv

Bkmk


8 posted on 02/25/2026 10:26:16 AM PST by sauropod
[ Post Reply | Private Reply | To 1 | View Replies]

Grok: Please summarize to 750 words or less

This YouTube video, titled **”The Genius of Computing with Light”**, was uploaded on February 15, 2026, by **Dr Ben Miles** (a science communicator and optical physicist with a PhD background connected to PsiQuantum). It has garnered over 246,000 views shortly after release and runs approximately 32 minutes.

The video is an in-depth, behind-the-scenes explainer on **PsiQuantum**, a secretive Silicon Valley startup leading the race toward utility-scale quantum computing using **photonic** (light-based) technology. Dr. Ben Miles gained rare access to their facilities and team, including interviews with experts like Dr. Ben Buridge and Mark Thompson. He tours their setup and breaks down the engineering in accessible, engaging terms with visuals, diagrams, and on-site footage.

**Key segments** (from timestamps in the description/transcript):
- **0:00–1:38**: Introduction to PsiQuantum’s secretive work in Silicon Valley.
- **1:38–6:03**: Why photonic quantum computing uses light (photons) — advantages include minimal decoherence (quantum states last longer), ability to propagate over kilometers without destruction, and compatibility with existing fiber optics.
- **6:03–9:00**: Generating single photons via spontaneous four-wave mixing in silicon ring resonators pumped by a 1515 nm laser.
- **9:00–10:48**: Building a “quantum clock” for precise timing.
- **11:54–15:00**: Detecting single photons with superconducting nanowire single-photon detectors (SNSPDs) achieving 93–99% efficiency; “heralding” ensures non-destructive measurement.
- **15:00–18:19**: Engineering the “perfect material” — silicon waveguides integrated with barium titanate oxide (BTO) for fast electro-optic switching.
- **18:19–21:45**: Performing quantum math with light using Mach-Zehnder interferometers (phase delays via thermooptic effects) to create superpositions and entanglement.
- **21:45–24:27**: Scalability roadmap — modular, distributed architecture with cryostats operating at 2 Kelvin.
- **24:27–27:25**: Innovative “space-to-time” conversion: Encoding qubits in time bins for reliable transmission over optical fibers (demonstrated with 99.7% fidelity over 250 meters).
- **27:25–end**: The first photonic quantum computer demonstrator, showing qubit tunneling between chips.

The core theme is how PsiQuantum overcomes traditional quantum challenges (e.g., qubit fragility in superconducting or trapped-ion systems) by leveraging photons’ stability and telecom compatibility. Their approach aims for **millions of qubits** in utility-scale machines (deployable for real-world problems like drug discovery or optimization), with planned sites in Australia and Chicago. A linked Nature paper (2025) supports the tech claims.

**Style**: Educational and enthusiastic science communication — clear explanations, no heavy math overload, visuals of hardware (chips, cryostats, lasers), and excitement about “taming quantum randomness.” It includes a Shortform book summary ad and promotes Dr. Miles’ Patreon/Substack/merch.

Viewer comments praise the depth (e.g., “mind-blowing,” “hidden gem”), single-photon isolation feats, and hope for scientific progress. Pinned comment from Dr. Miles thanks viewers and plugs the sponsor.

Overall, it’s a standout explainer on one of the most promising (and secretive) paths to practical quantum computing, ideal for tech enthusiasts curious about photonic alternatives to mainstream approaches.

(Word count: 548)


9 posted on 02/25/2026 10:58:47 AM PST by Fractal Trader
[ Post Reply | Private Reply | To 1 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson