Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 9,661-9,6809,681-9,7009,701-9,720 ... 19,001-19,019 next last
To: PIF
Excellent info, thanks for posting.

ATACMs are having an impact on ruzzian logistics.

Hopefully, President Trump won't add any restrictions on or after January 20, 2025.

9,681 posted on 12/16/2024 6:53:32 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9676 | View Replies]

To: AdmSmith
FTA: "...North Korean forces engaging in attritional infantry assaults."

Attritional...willing to accept losses.

9,682 posted on 12/16/2024 6:56:35 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9680 | View Replies]

To: BeauBo
⚡️🇺🇦 Magyar showed the destruction of three 🇷🇺 Russian Z-STS "Akhmat" armored vehicles in the Donetsk region

https://x.com/front_ukrainian/status/1868556068416303487


9,683 posted on 12/16/2024 6:57:39 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9682 | View Replies]

Ukrainian army turns into a media circus: A gay veteran speaks at the national LGBT conference about his 'difficult' service under the guise of 'progressivism'.

Meanwhile, the West cheers this woke spectacle as the under-equipped Ukrainian forces are decimated on the battlefield.

pic.twitter.com/AVtfyMf2HK— Ian Miles Cheong (@stillgray) December 16, 2024


9,684 posted on 12/16/2024 6:59:16 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9679 | View Replies]

To: PIF
🔥🇺🇦 1st Special Operations Detachment «UA_REG» successfully mined the roads used by the Russian invaders to advance in the Kursk region.

https://x.com/GloOouD/status/1868628672623813117


9,685 posted on 12/16/2024 6:59:57 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9683 | View Replies]

Zelensky Warns: U.S. NATO Role at Stake Over Ukraine Funding

Last updated 24 minutes ago

Ukrainian President Volodymyr Zelensky has warned that if the United States stops funding the war in Ukraine, it risks losing its leadership role within NATO and on the global stage. This statement has sparked a range of reactions on social media, with some users expressing skepticism or outright opposition to continued U.S. involvement in NATO, while others debate the organization's relevance and the strategic implications for U.S. foreign policy.

This story is a summary of posts on X and may evolve over time. Grok can make mistakes, verify its outputs.


9,686 posted on 12/16/2024 7:37:51 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9685 | View Replies]

To: Rocco DiPippo; JonPreston; kiryandil; mass55th; bimboeruption; aMorePerfectUnion
Good riddance you sick, death-loving, leftist ghoul.

Agree. These people who celebrate bloodshed and death give me the creeps. That poster in particular got off on grisly snuff videos. That’s psychotic.

9,687 posted on 12/16/2024 7:48:14 AM PST by Allegra (Deplorable garbage)
[ Post Reply | Private Reply | To 9675 | View Replies]

To: BeauBo; JonPreston; Rocco DiPippo
…those lying commie bastards get you down -

Project much?

That you would refer to FReepers who disagree with you on Biden/Obama/Soros policies outs you as one of them.

We’re Americans and we are correct in questioning and opposing billions of our tax dollars being sent to a known money laundering operation with no auditing or accountability.

You little foreigners coming onto our site and yapping your tired little insults are a joke.

This is precisely why we mock you and laugh at you.

9,688 posted on 12/16/2024 8:13:31 AM PST by Allegra (Deplorable garbage)
[ Post Reply | Private Reply | To 9671 | View Replies]

To: gleeaikin

9,689 posted on 12/16/2024 8:29:48 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9592 | View Replies]

To: AdmSmith
1 070 incl norks

At least thirty North Korean soldiers were killed or wounded during assault operations in Russia’s Kursk Oblast, Ukrainian military intelligence (HUR) claimed on Dec. 16.
Following the attacks that took place on Dec. 14-15 near the villages of Pliekhovo, Vorozhba, and Martynovka, North Korean losses have to be replenished by fresh soldiers from North Korea's 94th Separate Brigade, HUR claimed.



https://kyivindependent.com/30-north-korean-troops-killed-wounded-hur-says/
9,690 posted on 12/16/2024 8:36:43 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9606 | View Replies]

To: gleeaikin; PIF; blitz128; FtrPilot; BeauBo; USA-FRANCE; canuck_conservative; marcusmaximus; ETCM
Кремлевская табакерка

Belousov confirmed our insider information about a major war with NATO. Sources expect two waves of mobilization and express concerns.

The Minister of Defense allowed for a military conflict between Russia and NATO in the next decade. Thus, he confirmed our insider information. Back in May, we wrote that a war with NATO was possible in the coming years. And in September, our sources noted : now Russia is not ready for a major military clash with the West, it takes time to prepare. Andrei Belousov, in fact, confirmed these theses - a war is possible, but not now.

Our sources perceived Belousov’s statements differently. A general close to Valery Gerasimov saw in them a hint of an imminent large-scale mobilization. “For a war with NATO, we need more people. Even if it begins in a few years, it is already necessary to train personnel, in particular, by participating in the SVO (where else can you get valuable experience?). Therefore, I expect at least two waves of serious mobilization. The first - already in the winter, at the latest - in the spring of 2025 ,” he said. We noted that Belousov in his statements focused on contracts signed by new servicemen, and not on mobilization. “The figure of 427 thousand was mentioned there. This is not enough for a war with NATO. Millions of new troops are needed,” the channel's interlocutor responded.

Another source praised Belousov and noted: “NATO has always been afraid of us. And under Trump, it looks like it will be even more afraid. It's good that Andrei Removich played on this fear.”

Another of our interlocutors in the Ministry of Defense disagreed with him. “My opinion will not be popular, but I ask you to publish it. There is no point in rattling weapons and talking about a war with NATO now. We cannot defeat Western proxies from Kiev yet. What if the Americans listen to Andrei Removich and decide to increase aid to Ukraine? Who will be responsible for the retreat on several sections of the front that this could lead to? What if NATO launches preventive missile strikes? I hope that we will be more restrained now in order to prepare well for a war with NATO in the future. I also hope that Andrei Removich and Vladimir Vladimirovich will hear me. Consider this a public appeal to them,” the military man noted. We can guarantee that they will hear and read this post. But we are not yet ready to predict what will happen next.

https://t.me/kremlin_secrets/5042

The Russians are ashamed of not having managed a 3-day war against Ukraine. Putin cannot accept that Russian history books should say that he started a war against Ukraine that he lost, so he wants to expand it because losing to NATO is not as shameful.

9,691 posted on 12/16/2024 8:53:37 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9610 | View Replies]

To: Allegra; BeauBo
You little foreigners coming onto our site and yapping your tired little insults are a joke.

Ukranian-First Clowns.

Now that Trump has promised peace, and with Speedy running away, it's time for these Snuff Film aficionados to fold things up.

9,692 posted on 12/16/2024 10:25:49 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9688 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Russian “Blitz” Turns Into Carnage ]


Today [ Dec 16, 8 pm ], there are a lot of important updates from the Toretsk [ Avdiivka ] direction.

Here, Russian forces, unable to break through the northern flank, redirected their efforts southward, in an effort to escape the misery of urban combat. Instead, they found themselves in a deadly trap, stuck in the lowlands with Ukrainians on the heights, allowing Ukrainian forces to unleash precise and devastating tank raids.

The primary objective of the Russian forces in this area is to capture Toretsk. However, the battle for the city, with its complex urban warfare dynamics, has proven exceptionally difficult for them.

Toretsk, along with the surrounding settlements of Zalizne, Druzhba, and Pivnichne, forms a 30-square-kilometer urban agglomeration similar in size to Bakhmut. This scale has allowed Ukrainian forces to effectively slow the Russian advance over the past 6 months.

As a result, the Russians have suffered unsustainable daily casualties - up to 100 per day - during their attempts to secure the town. This high attrition rate has forced them to shift their focus to the flanks, hoping to encircle and isolate Toretsk with fewer losses.

As mentioned in the previous report, the Russian attempt to flank over the northern part of the town ended in failure. This left the Russian forces with one remaining option: the southern flank. The Russian advance in this area was made possible by their control of Niu-York, which allowed them to gather forces and equipment here.

Their plan is to push north of Niu-York along the Kryvyi Torets River toward Shcherbynivka. Capturing the village would enable the Russians to launch flanking attacks on Toretsk, sever the main supply route to the town, weaken Ukrainian defenses, and potentially set the stage for a renewed offensive from the north.

However, the Russian advance on the southern flank puts their forces in a precarious position. If we look at the topographic map, we can see that Shcherbynivka and the surrounding settlements are located in the lowlands of the Kryvyi Torets River valley.

This gives Ukrainian forces the advantage of higher ground to the west of Shcherbynivka, at Katerynivka, and from Toretsk, allowing them to establish fire control and effectively suppress any Russian attempts to advance toward Shcherbynivka, Leonidivka, and Petrivka. As a result, Russian forces would find themselves trapped in a cauldron, exposed to fire from all directions.

Despite these tactical disadvantages, the Russian commanders decided to initiate attacks in this area, hoping that the advancing forces would be able to conceal themselves from fire in residential houses and consolidate their positions. To improve their concealment and the chances of success, Russian forces deployed and concentrated their forces in small groups within residential areas of Niu-York and Nelipivka at night, to prevent their detection by the Ukrainians.

This allowed small infantry groups of up to eight Russian stormtroopers to attempt infiltrations through Ukrainian lines under the cover of night. However, geolocated footage reveals that Ukrainian drone operators quickly detected and eliminated the Russian units as they sought shelter in between the destroyed houses.

Additionally, Ukrainians preemptively countered the Russian assaults by launching tank raids on Russian forces gathering in the tree lines.

Combat footage shows how T-64BV tanks, aided by reconnaissance from drone units, effectively identified Russian positions and fired on them with their main guns, destroying the Russian force’s concentrations. These tank raids proved highly successful, thwarting larger Russian assaults by eliminating forces still grouped together during their final preparations.

Overall, the Russians launched a poorly planned counterattack on the southern flank of Toretsk, hoping to encircle the city from the south, only to place their troops in a semi-encirclement themselves, due to Ukrainian fire control from the high ground and subsequent tank raids. Russian forces also do not have the available reserves to properly intensify their assaults on the flanks.

Several Russian analysts and soldiers on the ground have already critiqued their commanders for sending wounded Russian soldiers back into battle, for lack of available reserves. As the insufficient number of reserves does not allow Russians to maintain an overwhelming force in the area, Ukrainians are launching precision counterattacks to strike the Russian efforts where they are weakest.


9,693 posted on 12/16/2024 12:35:28 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9689 | View Replies]

To: FtrPilot

Ukrainian F-16 Footage That Russia Doesn’t Want You to See
https://www.youtube.com/watch?v=G2ymp7kLclw


9,694 posted on 12/16/2024 2:33:30 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9685 | View Replies]

To: PIF; FtrPilot

Another Su-34 shot down, and crew lost.

so that is what F-16 doing.

More F-16s keep coming. Mirage pilots in training too.


9,695 posted on 12/16/2024 4:17:14 PM PST by BeauBo
[ Post Reply | Private Reply | To 9694 | View Replies]

To: BeauBo

Kyiv got a street named after Taras ‘Bulba' Borovets, a Ukrainian nationalist, Nazi collaborator, and Holocaust perpetrator. He ruled Olevsk, Zhytomyr oblast, for a few weeks after the collapse of Soviet power in the summer of 1941. At that time, the "Sich" militia organized a… pic.twitter.com/C2W72YMXCK— Marta Havryshko (@HavryshkoMarta) December 16, 2024


9,696 posted on 12/16/2024 4:28:18 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9695 | View Replies]

Zelensky’s curse struck again!

Scholz lost the confidence vote and is hence out, new election coming in Germany! pic.twitter.com/XM377Gpb5c— Lord Bebo (@MyLordBebo) December 16, 2024


9,697 posted on 12/16/2024 4:31:36 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9696 | View Replies]

To: JonPreston

Ukraine has requested electricity imports in the amount of more than 20 thousand MW per hour from Poland, Romania, Slovakia, Hungary and Moldova, the country’s Ministry of Energy reported.

When once they supplied Europe now they ask for it back.— ayden (@squatsons) December 15, 2024


9,698 posted on 12/16/2024 4:32:25 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9697 | View Replies]


9,699 posted on 12/16/2024 4:33:55 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9698 | View Replies]

Putin slams Dictator Zelenskys plan to lower the conscription age in Ukraine

"They hunt men like dogs in the street and send them to face the bullets, now they want to do the same to young boys"

Ironically, Vladimir Putin has more concern for ordinary Ukrianians than Zelensky pic.twitter.com/afrLykElL6— Chay Bowes (@BowesChay) December 16, 2024


9,700 posted on 12/16/2024 4:35:36 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9699 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 9,661-9,6809,681-9,7009,701-9,720 ... 19,001-19,019 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson