Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 8,681-8,7008,701-8,7208,721-8,740 ... 19,421-19,422 next last
To: gleeaikin
Russian Offensive Campaign Assessment, November 23, 2024

Russian Mobilization and Force Generation Efforts (Russian objective: Expand combat power without conducting general mobilization)

Kremlin Spokesperson Dmitry Peskov stated that Russia does not currently need to conduct another partial involuntary reserve callup as Russian authorities continue leaning into crypto-mobilization efforts. Peskov stated on November 23 that Kremlin officials are not currently discussing a second round of mobilization and that Russia is currently recruiting sufficient numbers of contract volunteer personnel.[58] Other Russian authorities continue efforts to incentivize further contract volunteer recruitment. Russian President Vladimir Putin signed a law on November 23 allowing Russian soldiers who fought in Ukraine to write off loans up to 10 million rubles (about $95,869) if Russian courts initiate debt collection proceedings before December 1, 2024, likely to incentivize Russians with existing debt to sign contracts with the Russian Ministry of Defense (MoD).[59] A Russian milblogger amplified a recruitment advertisement for military service within Russian Airborne (VDV) units in multiple Russian federal subjects, promising to cover recruits’ travel expenses to sign contracts.[60] The advertisement also offered one-time payments of 2.5 million rubles (about $23,967) for contracts signed in Tula Oblast, 3 million rubles (about $28,760) for contracts signed in Belgorod and Nizhny Novgorod oblasts, and 2.1 million rubles (about 20,132) for contracts signed in Leningrad Oblast.

The Russian government remains concerned about the economic cost of continuing to wage war in Ukraine, particularly in compensating Russian soldiers. The Russian MoD submitted a draft law on November 22 that would oblige Russian soldiers to return their one-time payments from signing Russian military contracts if the soldiers commit a “gross disciplinary offense” or evade military duties.[61] Putin has recently indicated that he is concerned about Russia's long term economic stability, including by decreasing payments due to Russian soldiers injured on the battlefield.[62] The Russian MoD likely intends for this draft law to incentivize better discipline among Russian military personnel, particularly as Russian military personnel continue to publicly complain about the Russian military command's poor treatment of Russian soldiers.

Former commanders of the Wagner Group private military company (PMC) have reportedly formed a new PMC unit called “Wagner Legion.” Russian milbloggers amplified an image of former Wagner Group commanders, callsigns “Rusich,” “Cap,” “Ratibor,” “Marx,” and “Radimir,” standing in front of a banner bearing the insignia of the Wagner Legion and claimed that “Cap” is leading the new unit.[63] The milbloggers claimed that Wagner Legion is already recruiting and training new fighters. The Russian MoD has notably attempted to subsume the Wagner Group following the death of its former financier Yevgeny Prigozhin by piecemealing remaining Wagner personnel to various Russian military formations, and the extent of Wagner Legion's subordination to the Russian MoD or other security structures is unclear. Chechen Republic Head Ramzan Kadyrov claimed in April 2024 that Wagner commander Alexander Kuznetsov (callsign “Ratibor”) would join the Chechen Akhmat Spetsnaz with 3,000 Wagner personnel and indicated that the Wagner personnel would be subordinated under the Russian MoD.[64]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-november-23-2024

8,701 posted on 11/24/2024 3:22:25 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8666 | View Replies]

Snow


8,702 posted on 11/24/2024 3:24:54 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8665 | View Replies]

To: ETCM; PIF
Nabiullina [governor of the Central Bank of Russia] admitted the beginning of an economic crisis in Russia, the media writes, citing sources. The head of the Central Bank made an “extremely pessimistic” forecast during a non-public meeting. According to sources, the head of the Central Bank admitted the risk of the country's economy sliding into recession, and it will be impossible to defeat inflation in the short term.

Earlier, the Institute of Economic Forecasting of the Russian Academy of Sciences admitted the futility of raising the Central Bank's key rate. According to experts, each percent reduces inflation by only 0.1%, and consumer demand by 0.2%. Thus, a possible increase in the key rate from 21 to 23% at the Central Bank meeting in December will reduce inflation by only 0.2%.

https://t.me/bankrollo/34914

8,703 posted on 11/24/2024 3:35:54 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8698 | View Replies]

To: AdmSmith
🔞 Perhaps the best for today.

Work of drone operators of The Ravens group of the 129th Territorial Defense Brigade in the eastern section of the Kursk operational zone.

Occasionally, the operators seem to play with the enemy before finishing him off.

https://x.com/albafella1/status/1860631834087878872

4:07 video at the link above.


8,704 posted on 11/24/2024 5:44:57 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8703 | View Replies]

To: PIF
⚡️🇺🇦 Ukrainian soldiers from the 36th Marine Brigade repel a 🇷🇺 Russian offensive in the Kursk region

https://x.com/front_ukrainian/status/1860585424466378996


8,705 posted on 11/24/2024 5:57:07 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8704 | View Replies]

To: PIF
Ukrainian Forces 🇺🇦 report destroying a Russian S-400 SAM Radar overnight in Kursk using US 🇺🇸 ATACMS missiles

This is the 2nd target struck inside Russia by Ukraine using ATACMS

https://x.com/ukraine_map/status/1860623787311452361


8,706 posted on 11/24/2024 6:19:01 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8705 | View Replies]

To: FtrPilot

Ukraine Lost Nearly Half The Territory It Captured In Russia: Report
Ukraine Situation Report: Ukraine’s President Zelensky said Russia is trying to push his forces out of Kursk before Trump returns to the White House.
https://www.twz.com/news-features/ukraine-lost-nearly-half-the-territory-it-captured-in-russia-report


8,707 posted on 11/24/2024 6:21:57 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8705 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Russians Tried to Cross The Canal. Immediate Regret ]


Today [ Nov 24 ], there are many interesting updates from the Chasiv Yar direction.

Here, after months of relentless fighting, the Russians adopted a new strategy to try and capture Chasiv Yar. While their initial assaults yielded some success, logistical overextension left their forces vulnerable and exposed to Ukrainian forces, setting the stage for the counterattacks that aim to collapse their bridgehead.

Earlier, Russian forces established a bridgehead on the Ukrainian side of the Siverskyi Donets-Donbas canal, exploiting a gap in the canal’s defenses where an overground passage allowed foot crossings. Their primary tactical advantage in this sector lies in the nearby forest, which provides substantial cover for covert troop movements and deployments, enabling them to carry out operations with reduced exposure to Ukrainian defenses.

Additionally, Russian troops in the area enhance their concealment by wearing thermal coats, reducing their visibility to Ukrainian drones equipped with thermal and night-vision cameras. However, they face significant logistical challenges that hinder their operational effectiveness.

The lack of adequate supply routes and vehicle passages limits their ability to receive sufficient food and ammunition, making it difficult to sustain large-scale operations. Furthermore, Ukrainian positions in Chasiv Yar, situated on elevated terrain, provide a commanding view of Russian positions to the south, exposing them to Ukrainian fire control and further weakening their tactical advantage.

Russian forces in this sector are primarily composed of infantry, as the destruction of the only bridge to the west side of the canal has prevented the deployment of mechanized units such as tanks and infantry fighting vehicles. This severely limits their ability to conduct high-firepower, mobile assaults.

Additionally, once Russian troops move beyond the forest’s cover, they become vulnerable to Ukrainian artillery strikes and drone surveillance, further compounding their difficulties and diminishing their operational effectiveness.

Initially, Russian forces employed small-scale ambushes using hit-and-run tactics to weaken nearby Ukrainian defenses, successfully destroying several Ukrainian armored vehicles and inflicting troop losses. Leveraging their concealment in the forest, they gained a short-term tactical advantage, allowing them to assault and seize Ukrainian positions in the open, including a nearby mine and surrounding trench systems.

However, the Russians’ short-term success quickly dissipated, once their element of surprise was lost. Combat footage from the area shows how their exposure in open terrain allowed Ukrainian drone operators to identify and target Russian positions effectively, inflicting heavy losses and suppressing their defenses.

The sudden and precise Ukrainian strikes caused panic among the Russian soldiers, prompting some to abandon their positions and retreat hastily across the canal.

This allowed Ukrainian forces to deploy drones for continuous surveillance of the newly gained Russian positions, directing precision strikes to suppress them further, as they remained exposed in open fields. Ukrainian counterattacks leveraged their superior firepower, utilizing tanks and infantry fighting vehicles against the poorly supplied Russian infantry.

With limited ammunition and resources, the Russian forces were unable to sustain prolonged engagements, leading to significant losses or retreat. Ultimately, the overwhelming Ukrainian firepower and strategic advantage forced the remaining Russian units to withdraw back into the forest.

Overall, the Russian attack ultimately failed, leaving their exposed infantry formations overwhelmed by Ukrainian firepower which forced the Russians to retreat from the mine complex towards the forests. Because of this, their frontlines became increasingly unsustainable under relentless Ukrainian counterattacks.

Exploiting these vulnerabilities, Ukrainian forces secured a decisive advantage in this sector, setting the stage for further counteroffensives against the destabilized Russian bridgehead. Compounding their difficulties, the Russians’ inability to supply their units adequately across the canal has severely undermined their ability to mount a prolonged defense, leaving their positions highly susceptible to continued Ukrainian pressure.


8,708 posted on 11/24/2024 6:29:38 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8706 | View Replies]

To: PIF
Welcome To Russia, I will be your guide.

https://x.com/Bricktop_NAFO/status/1860645252664541275

Bucha is a suburb of Kyiv.

8,709 posted on 11/24/2024 6:55:04 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8706 | View Replies]

To: BeauBo
🔥 Who would have known that the Russians’ Chinese-made golf carts don’t do well on the battlefield when hit with Ukrainian 🇺🇦 artillery??

👉 The good news is that those Russian occupiers won’t be trying it again.

https://x.com/officejjsmart/status/1860360740743360945


8,710 posted on 11/24/2024 7:43:00 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8709 | View Replies]

To: PIF
More vodka please.

Russian forces in a buggy run over a sapper trying to warn them about mines on the road.

Moments later, they hit the mines themselves

https://x.com/NOELreports/status/1860710449450270722


8,711 posted on 11/24/2024 7:48:33 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8710 | View Replies]

Survived 3 weeks... including transport to the battlefront.

Retired police Major Гривас Владимир Михайлович (Grivas Vladimir Mikhailovich) volunteered for the war on 12 January ’24 and was eliminated near Pobieda (“Victory”), Ukraine on 2 February ’24.

https://x.com/KilledInUkraine/status/1860639882806280285


8,712 posted on 11/24/2024 8:02:50 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8711 | View Replies]

To: PIF
A US-made M2A2 Bradley rolling through Russia, somewhere in the Kursk region.

https://x.com/Tendar/status/1860714687492452727


8,713 posted on 11/24/2024 8:10:32 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8712 | View Replies]

To: FtrPilot
Сomponents in the aggressor`s [Russia] weapon
The world`s only open database portal of foreign-produced weapon components
Thousands of electronic components, originally intended to improve lives and fuel development, are perversely repurposed by aggressors into instruments of violence. These weapons rely heavily on foreign-made components. Disrupting this supply chain is critical to impede their ability to fight, occupy and kill.

https://war-sanctions.gur.gov.ua/en/components

Example: Check Swizz producers https://war-sanctions.gur.gov.ua/en/components?f%5Bcountry_id%5D=204&f%5Bmanufacturer_id%5D=&f%5Btitle_uk%5D=&i%5Bmarking%5D=&f%5Bsearch%5D=

8,714 posted on 11/24/2024 10:47:47 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8713 | View Replies]

Evgen Istrebin:
Please retweet in advance.
This will be a long thread in which I will explain and show the approach of mass corporate defaults in Russia.
I will also show that Putin’s economy is currently in the worst possible position.
Here is the IFX-CBONDS G-SPREAD index. It shows the difference between the yield of OFZ and corporate bonds. It is currently at a historical maximum. The huge growth occurred after November 5.

https://x.com/evgen1232007/status/1860655294264549445

This shows that the Russian economy is rapidly collapsing and that it is difficult to refinance loans/bonds.


8,715 posted on 11/24/2024 10:59:55 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8714 | View Replies]

here as well https://bsky.app/profile/evgen-istrebin.bsky.social


8,716 posted on 11/24/2024 11:28:24 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8715 | View Replies]

Bloomberg: Putin’s Assassination Targets Revealed in Declassified Memo
The Office of the Director of National Intelligence has released a long-classified memorandum shedding light on the targeted killings of Vladimir Putin’s political adversaries, following nearly eight years of persistent public records efforts.

Prominent critics of the Kremlin, and Putin in particular, seem to have a terrible habit of dropping dead under very suspicious circumstances. Some fall out of windows, bludgeon themselves to death, are poisoned or are said to have committed suicide in ways that defy logic. Anonymous US intelligence officials have long said they suspected that some of the mysterious deaths over the years were part of a campaign by Putin to assassinate his enemies. But internal US government documents that contained such explicit assertions have never really surfaced. Until now.

https://www.bloomberg.com/news/newsletters/2024-11-22/putin-s-assassination-targets-revealed-in-declassified-memo


8,717 posted on 11/24/2024 11:39:50 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8716 | View Replies]

To: ETCM; PIF
Why was the interest rate raised to 23%?

Prices in The Fog of War: Actual consumer inflation in Russia may be higher than official data, while actual industrial growth may be lower

In September 2024, ROMIR recorded a 22.1% year-on-year price increase for everyday goods, compared to 10% according to Rosstat.
https://re-russia.net/en/analytics/0202/

8,718 posted on 11/24/2024 12:19:06 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8703 | View Replies]

To: FtrPilot

Kremlin snuff box, 11/24/24
https://t.me/s/kremlin_secrets

Kim Jong-un is dissatisfied with the provision of North Korean troops at the front

The DPRK troops in the Kursk region, by and large, have not yet taken an active part in hostilities, but conflicts around them continue. In addition to everyday moments, a political context also arose.

On Saturday, November 23, there was contact between Pyongyang and Moscow through the Ministry of Defense.

“Our North Korean partners decided that now is the best time to express dissatisfaction with the availability of weapons to their fighters. They say there is not enough equipment. They are dissatisfied that North Korean troops have already suffered losses as a result of missile attacks,” says a source in the General Staff.

At the same time, he noted a simple truth - if Koreans die, then more of ours will survive.

“There are rumors that the situation with North Korean troops in the Kursk region is under personal control of Kim Jong-un,” said a source in the Ministry of Defense.


8,719 posted on 11/24/2024 12:35:00 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8713 | View Replies]

To: AdmSmith

Kremlin snuff box, 11/24/24
https://t.me/s/kremlin_secrets

Are we facing a terrible crisis, why does Nabiullina want the urgent completion of the SVO, and will payments to the military be reduced for contracts?

Colleagues wrote that Elvira Nabiullina predicts a large-scale economic crisis in Russia. But the government’s economic bloc does not confirm this forecast. We don’t want to scare anyone, but we must say a few words about this situation.

Firstly, our insight is confirmed. Back in October, we reported that the head of the Central Bank is in despair over the situation in the economy and even wants to ask Vladimir Putin to finish the SVO. Nabiullina never made such a request to the President (let’s face it, she was afraid); she preferred to increase the key rate.

But in personal conversations, he constantly notes that “the fighting needs to end urgently.” “Otherwise, next year the dollar will be 120-150 ruble, prices will rise by at least 20%, lending in the country will completely stop,” our source in the leadership of the Central Bank explained this position.

Secondly, Nabiullina is trying to achieve a reduction in payments to the military, including for concluding contracts. We wrote that she has already achieved savings on some of the wounded military. But at the moment it is not possible to reduce payments to new contract workers.

“There is a 30 percent chance that Nabiullina will achieve her goal. I hope not now, but a little later. We’re still holding out,” our source in the Kremlin said about this.

Thirdly, a number of people who have influence on the President are seeking Nabiullina’s resignation. They propose the candidacy of Sergei Yuryevich Glazyev to replace the head of the Central Bank. He often criticizes Nabiullina, and in personal conversations promises to “sharply and firmly” solve problems with the dollar exchange rate, prices and the Russian economy in general.

Vladimir Vladimirovich is considering the issue of Nabiullina’s resignation and Glazyev’s appointment. But not too actively yet - fears of another part of the President’s entourage are hindering. They call Sergei Yuryevich at the head of the Central Bank “a guarantee of the end of Russia next year.”

At the same time, an attempt to return Anatoly Chubais to Russia may work against Nabiullina ( we wrote about this ).


8,720 posted on 11/24/2024 12:38:24 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8718 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 8,681-8,7008,701-8,7208,721-8,740 ... 19,421-19,422 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson