Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 6,981-7,0007,001-7,0207,021-7,040 ... 19,521-19,535 next last
To: BeauBo

I am on board with you. Trump demanded that NATO members pay their fair share(popular phrase on the other side), but true in this case. He was against nord stream and warned Europe about being dependent on Russia for energy.

I will take my chances with supporting Trump and his policies over a liar whose policies will destroy America and at that point NATO is mute.

Put another way, if Europe had been preparing like they should have over the past decades, then many of the issues about supplying Ukraine would not be happening and even more important Putin would not have invaded Ukraine if they had.

Putin sensed weakness and he made his mov, just like a certain corporal with a bad mustache did decades ago


7,001 posted on 10/08/2024 5:27:37 AM PDT by blitz128
[ Post Reply | Private Reply | To 7000 | View Replies]

To: SpeedyInTexas

Russia’s S-70 Hunter Drone Was Armed When Shot Down by Friendly Fighter Over Ukraine
Evidence from the crash site points to the flying wing drone having flown a combat test mission with glide bombs.
https://www.twz.com/air/russias-s-70-hunter-drone-was-armed-when-shot-down-by-friendly-fighter-over-ukraine


Chinese Laser Anti-Drone System Spotted in Iran
A very high-profile appearance by Iran’s Ayatollah Ali Khamenei has given us a glimpse at some of China’s latest counter-drone technology.
https://www.twz.com/news-features/chinese-laser-anti-drone-system-spotted-in-iran


China’s Monster Amphibious Assault Ship Has Twin Island Superstructures Optimized For Aviation Ops
The twin island superstructures would make the huge Type 076 even more suitable for accommodating a diverse air wing.
https://www.twz.com/sea/chinas-monster-amphibious-assault-ship-has-twin-island-superstructures-optimized-for-aviation-ops


7,002 posted on 10/08/2024 5:39:13 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6999 | View Replies]

To: BeauBo; blitz128; SpeedyInTexas
In 2006, NATO Defence Ministers agreed to commit a minimum of 2% of their Gross Domestic Product (GDP) to defence spending to continue to ensure the Alliance's military readiness. This guideline also serves as an indicator of a country's political will to contribute to NATO's common defence efforts, since the defence capacity of each member has an impact on the overall perception of the Alliance's credibility as a politico-military organisation.

https://www.nato.int/cps/en/natohq/topics_67655.htm

All US administrations since 2006 have pushed for members to increase defense budgets above 2%, and this was particularly emphasized again in 2014;

The Defence Investment Pledge endorsed in 2014 called for Allies to meet the 2% of GDP guideline for defence spending and the 20% of annual defence expenditure guideline on major new equipment by 2024. Since Russia's full-scale invasion of Ukraine in February 2022, a majority of Allies have committed to investing more, and more quickly, in defence.

At the 2023 Vilnius Summit, NATO Leaders agreed a new Defence Investment Pledge, making an enduring commitment to investing at least 2% of GDP annually on defence. They also affirmed that in many cases, expenditure beyond 2% of GDP will be needed in order to remedy existing shortfalls and meet the requirements across all domains arising from a more contested security order. The new Defence Investment Pledge also calls for Allies to meet the 20% of annual defence expenditure guideline on major new equipment, including research and development.

In 2024, 23 Allies are expected to meet or exceed the target of investing at least 2% of GDP in defence, compared to only three Allies in 2014. Over the past decade, European Allies and Canada have steadily increased their collective investment in defence – from 1.43% of their combined GDP in 2014, to 2.02% in 2024, when they are investing a combined total of more than USD 430 billion in defence.

https://www.nato.int/cps/en/natohq/topics_67655.htm

7,003 posted on 10/08/2024 6:07:18 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7000 | View Replies]

To: PIF
Now heading into 48 hours burning, Russia's most important oil facility in Crimea continues the path to oblivion.

Russians are skilled at many things, like murdering unarmed families, raping, stealing copper piping and toilets from homes, but putting out fires is NOT one of them

https://x.com/JayinKyiv/status/1843605700959973572


7,004 posted on 10/08/2024 6:08:39 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 7002 | View Replies]

Russian Offensive Campaign Assessment, October 7, 2024

Russian authorities announced an “unprecedented” cyberattack against Russian state media infrastructure on October 7. The All-Russia State Television and Radio Broadcasting Company (VGTRK) reported that unspecified actors hacked VGTRK’s online services overnight in an “unprecedented” attack, and pro-Kremlin Russian news outlet Gazeta reported that the attack took down broadcasts of Russian state television channels Rossiya-1, Rossiya-24, Rossiya Kultura, Karusel, and roughly 80 regional television and radio companies.[9] Gazeta cited a source in the Russian information security field claiming that hacker group “sudo rm -RF,” which is allegedly linked to Ukraine, conducted the cyberattack.[10] (The group’s name refers to a Linux command to delete files.) Ukrainian news outlet Suspilne, citing its own sources, stated that “sudo rm -RF” has claimed responsibility and that VGTRK employees complained that the attack deleted all backup information.[11] The information security expert claimed to Gazeta that the hackers most likely used a type of encryption virus that deletes files rather than just encrypting them and warned that VGTRK will now have to close the vulnerability in addition to recovering backups of its systems.[12] VGTRK claimed that its systems did not suffer significant damage despite the attack and that its systems are operating normally.[13] Kremlin Spokesperson Dmitry Peskov expressed support for VGTRK and characterized the cyberattack as an attack on Russian critical infrastructure.[14]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-october-7-2024


7,005 posted on 10/08/2024 6:11:41 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6964 | View Replies]


7,006 posted on 10/08/2024 6:17:35 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6966 | View Replies]

To: PIF
In addition to the cyber attack, Putler received other birthday presents:

The Rais (Head) of Tatarstan congratulated Putin and caused a serious scandal. The FSB will deal with the situation

Several influential people in Vladimir Putin's entourage were very unhappy with the fact that part of the congratulations from the Rais of Tatarstan Rustam Minnikhanov on the president's birthday were in the Tatar language. “I don't know what he wanted to say. But his congratulations seriously contradict everything we are fighting for. In particular, the development of the Russian language and Russian culture,” a high-ranking source in the Kremlin angrily told us.

Another went even further. He suspected Minnikhanov and people from his entourage of separatism. And he appealed to the FSB to sort out the situation. “Specialists will study the situation in Tatarstan. They will also check if there are any nationalist cells, terrorists, or anything else destructive. Kazan is an important city for Russia. And I believe that Vladimir Vladimirovich should not have listened to the Tatar language on his birthday,” our interlocutor said. He added that Putin initially saw “nothing criminal” in the congratulations in Tatar. But later the president was persuaded to take a closer look at Minnikhanov's actions. The FSB told us that “certain events will be held in Tatarstan.” The sources did not specify which ones.

https://t.me/kremlin_secrets/4747

and

Putin was given “death” for his birthday

Vladimir Putin received an unusual gift for the holiday from a major businessman, whose name our sources refuse to name. “The gift was strange. A figurine of death made of stone, very expensive. In a hood, with a scythe made of pure gold. The giver said that this is a symbol of the death of all the enemies of Vladimir Vladimirovich,” said a source in the president's entourage.

Putin did not like the gift very much, and he instructed the security “to hide it somewhere.” At the same time, Vladimir Vladimirovich did not express his displeasure to the businessman who brought “death.”

But Sergei Shoigu was not allowed to give the gift he wanted. “We learned that Sergei Kuzhugetovich wants to give Vladimir Vladimirovich part of the ashes of the commander Suvorov (who was taken out of the grave in the spring and taken to the front, - ed.). The president did not like this idea. And Shoigu was asked not to go to the Kremlin with these bones,” a source in the FSO told us.

https://t.me/kremlin_secrets/4749

7,007 posted on 10/08/2024 6:29:43 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7005 | View Replies]

To: PIF; All

Only 28 days until Trump ends the war ‘24 hours after the election’.

“Former President Donald J. Trump has secretly spoken with President Vladimir V. Putin of Russia as many as seven times since leaving office, even as he was pressuring Republicans to block military aid to Ukraine to fight Russian invaders, according to a new book by the journalist Bob Woodward.

The book, titled “War” and scheduled to be published next week, describes a scene in early 2024 at Mar-a-Lago, Mr. Trump’s estate in Florida, when the former president ordered an aide out of his office so he could conduct a phone call with Mr. Putin. The unidentified aide said the two may have spoken a half-dozen other times as well since Mr. Trump left the White House.

The book also reports that Mr. Trump, while still in office early during the Covid-19 pandemic in 2020, secretly sent Mr. Putin what were then rare tests for the virus for the Russian’s personal use. Mr. Putin, who has been described as particularly concerned about being infected at the time, urged Mr. Trump to not publicly reveal the gesture because it could damage the American president politically. “I don’t want you to tell anybody because people will get mad at you, not me,” Mr. Putin reportedly told him.”


7,008 posted on 10/08/2024 7:36:03 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6998 | View Replies]

To: PIF; All

“Mr. Trump praised Mr. Putin as a “genius” when he initiated the full-scale invasion of Ukraine in 2022 and since then has refused to say that he wants Ukraine to win its war against Russia. He has criticized American aid to Ukraine and leaned on congressional Republicans not to approve more assistance. He has boasted that if he wins he will negotiate an end to the war in Ukraine within 24 hours and do so even before the inauguration.”


7,009 posted on 10/08/2024 7:39:31 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7008 | View Replies]

To: PIF; All

They could have stayed at home and played with the grand kids.

“Four other Russian soldiers recently killed in Ukraine. Evgeny Sysoev was 59, Vladimir Kapitonov was 55, Vladimir Dotts was 48, and Andrey Voevodin was 56. “

https://x.com/RALee85/status/1843432022460510353


7,010 posted on 10/08/2024 7:46:33 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7009 | View Replies]

The fire in Feodosia keeps expanding. Firemen are struggling to put an end to the fire that started after a Ukrainian attack yesterday on an oil facility.

https://x.com/NOELreports/status/1843622501718302979

I believe that UKF now attack the side of the storage tanks so that fuel leaks onto the ground before catching fire.

The fire then spreads to nearby storage tanks.

7,011 posted on 10/08/2024 7:46:53 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 7004 | View Replies]

To: PIF; All
“Satellite images have emerged showing the aftermath of a strike on the largest oil depot in Crimea. In the photos from October 8, plumes of smoke can be seen over the territory of the Feodosia terminal.”






7,012 posted on 10/08/2024 7:48:35 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7010 | View Replies]

To: PIF; All

“French Defense Minister Sébastien Lecorneuil stated that France will supply Ukraine with Mirage 2000 fighter jets, which will be equipped with new equipment before delivery. The modernized Mirage 2000s will be ready for delivery to Ukraine in the first half of 2025.”

https://x.com/wartranslated/status/1843582516063604768


7,013 posted on 10/08/2024 7:51:30 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7012 | View Replies]

To: PIF; All

“Destruction of a Russian mobile L-band 3-D surveillance radar 39N6 Kasta-2E2 by the 15th Artillery Recon Brigade.”

https://x.com/NOELreports/status/1843654590832750892


7,014 posted on 10/08/2024 7:54:17 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7013 | View Replies]

To: PIF; All

“North Korea is likely already sending its military to Ukraine to assist Russia, according to South Korea’s Defense Minister Kim Yong Hyun.

“We believe there have been injuries and fatalities among North Korean troops in Ukraine,” he said.”

https://x.com/NOELreports/status/1843652462139609457


7,015 posted on 10/08/2024 7:55:09 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7014 | View Replies]

To: PIF; All

Wonder Why?

“Hungary is blocking a €35 billion EU loan for Ukraine until after the U.S. elections on November 5, according to Euronews. The loan will use the windfall profits of the Russian Central Bank’s immobilised assets to gradually repay the money given to Kyiv.”

https://x.com/NOELreports/status/1843636081075597775


7,016 posted on 10/08/2024 7:56:20 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7015 | View Replies]

To: SpeedyInTexas

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Russian Strategic Base in Flames! ]


Today [ Oct 08 ], there are a lot of news from Crimea and the Russian Federation.

Here, Ukrainian forces continued their series of precision strikes against critical Russian military infrastructure, hitting targets within enemy territory. With drones and missiles, they aimed to cripple key assets, from ammunition depots to command posts, setting the stage for a major disruption of Russian military operations.

First of all, today Ukrainian drones targeted Feodosia in Crimea, striking a key Russian transshipment hub. This port infrastructure is not just an ordinary oil depot, but can receive tankers with oil products year-round, store them, and distribute them across the Crimean Peninsula.

Due to the attack, it sustained significant damage, and footage from the scene reveals extensive destruction, suggesting that oil logistics in the region will now rely more heavily on railways and roads, complicating transportation and, in turn, hindering the Russian use of mechanized forces in Ukraine.

Just several days prior to that, Ukrainian special forces launched several swarms of drones, with their first target being a fuel storage facility near Voronezh. Despite Russian officials claiming all drones were intercepted by electronic warfare systems, footage revealed fires raging at the complex after at least one vertical fuel reservoir was struck. A 2nd fuel depot in the Perm region was also hit, with flames engulfing an area of 10,000 square meters.

Videos shared by Russian locals on social media captured the impressive sight of Ukrainian jet-powered missile-drones flying at low altitudes and high speeds, rendering Russian defenses virtually powerless to stop them.

The next Ukrainian attack was aimed at the Borisoglebsk airfield in the Voronezh region and targeted KAB bomb warehouses, Su-35 aircraft, and their fuel storage. Explosions and fires were reported overnight by locals, with satellite data released showing several fire spots.

With inflicted damage hard to assess at first, these images show that while the fire may have not directly affected the planes or buildings, it potentially spread to nearby boxes and containers stored close to the runway with Russian air defense being unable to prevent another drone attack against one of its main military airfields.

Ukrainians managed to achieve this by conducting careful preparation and successfully targeting and destroying a Russian 96-L-6 Radar around 15 kilometers west of Belgorod, belonging to an S-400 air defense system. This radar can track up to 100 targets and classify them into different types: aircraft, helicopters, drones, or missiles. A Ukrainian reconnaissance drone, Shark, detected it and corrected the strike as seen on the released geolocated footage.

The second high-value target was the Russian Nebo-M radar station, which was destroyed by the Ukrainian Armed Forces using an ATACMS missile. This strike severely hampers Russia’s ability to detect, track, and intercept both aerodynamic and ballistic threats within a 600-kilometer range, especially as fewer than 10 of these systems remain operational, as Ukrainians have already destroyed around half of the initial number of them.

Valued at $100 million, the Nebo-M is notoriously difficult to neutralize, as it uses most modern technology to scan the horizon for aerial threats. Military analysts suggest its destruction is intended to create a clear air corridor, facilitating the effective deployment of Ukraine’s Storm Shadow cruise missiles.

With clear skies in their favor, Ukrainian drone operators successfully struck the Kotluban military arsenal in Russia’s Volgograd region. The attack targeted a facility used for storing and upgrading rocket artillery, which had recently received a shipment of Iranian missiles.

Despite robust defenses from Russian electronic warfare and air defense systems, Ukrainian forces completed their mission, triggering massive fires and ammunition explosions. Eyewitnesses reported over 10 powerful detonations at the depot, vividly capturing the scale of the destruction.

As if that weren’t enough, Ukrainian forces dealt another blow by successfully striking 3 key Russian command posts, including those of the 35th and 27th Separate Motorized Rifle Brigades, along with the command post of the 2nd Russian Combined Arms Army.

These precision attacks using Storm Shadow missiles and GMLRS rockets were designed to disrupt Russian command operations and so chaos in their ranks ,with results still being confirmed.

In the same wave of strikes a plant in Adiivka, housing Russian troops and equipment was also hit inflicting significant damage on Russia’s strike capabilities.

Overall, Ukraine stepped up its efforts to deal significant blows to the enemy by targeting not only ammunition depot, but all kinds of other key military infrastructure as well.

While still waiting for permission to use weapon systems provided by Western partners deep inside Russia, Ukrainian armed forces are trying to deal as much damage as possible with the newly developed cutting edge missile drones, and at an important time of the year, just before the weather makes any significant mechanized assaults impossible, and just when Russians are throwing out everything at any cost to win more territory


7,017 posted on 10/08/2024 8:03:03 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7014 | View Replies]

To: PIF; All

PANTSIR not on fire. A victory for RuZZia.

“First @planet satellite image showing the aftermath of the Ukrainian [missile or drone] strike on the Feodosia port oil depot, taken today, Oct. 8. As you can see, the ‘Pantsir’ system remains intact, despite being located right next to one of the burning fuel tanks”

https://x.com/kromark/status/1843638743040962695


7,018 posted on 10/08/2024 8:04:30 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7016 | View Replies]

To: SpeedyInTexas

“We believe there have been injuries and fatalities among North Korean troops in Ukraine,” he said.”


Numerous NK troops were being shown about Western weapons. Obligingly, said Western nation weapon was shown to them in the form of a cluster munition, sent with love from UKR troops.


7,019 posted on 10/08/2024 8:05:53 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7015 | View Replies]

To: SpeedyInTexas

... will be equipped with new equipment before delivery.

This "New equipment" should include an avionics upgrade which give the Mirage 2000 the ability to carry & launch Aim-120s, Aim-9s, JDAMs, SDBs, and LGBs.

7,020 posted on 10/08/2024 8:10:38 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 7013 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 6,981-7,0007,001-7,0207,021-7,040 ... 19,521-19,535 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson