Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 6,941-6,9606,961-6,9806,981-7,000 ... 19,361-19,372 next last
To: SpeedyInTexas

NATO to expand.

Putina is a Master Strategist. He/she/it is not just the top NATO recruiter of this century, but they/them/suchwhat has also achieved the biggest NATO budget and force structure increases of this century as well.

Kyiv Independent:

NATO to expand military forces and air defense due to increased threats, Die Welt reports

“NATO has been advised to significantly bolster its defense capabilities, as outlined in a report by German newspaper Die Welt.

This includes increasing the number of combat brigades from 82 to 131 and creating new corps and divisions, raising their number from 24 to 38, to meet the minimum defense requirements. (This is a major Defense build up - more than a 50% larger force)

Additionally, NATO must rebuild its ground-based air defense and expand its air and transport capabilities.

These recommendations were approved and signed by the Supreme Commander of NATO in Europe, Christopher J. Cavoli, and the head of the command for transformation, Pierre Vandieu, reflecting the urgent need for stronger collective security in light of growing global threats.

On July 18, NATO Secretary General Jens Stoltenberg told the BBC that NATO allies must prepare for the worst-case scenario of a decade-long war in Ukraine (Speedy called that first).

“The main message is that the stronger the support for Ukraine and the longer we are willing to commit, the sooner this war can end,” Stoltenberg told the BBC. “The paradox is that now (Russian) President Putin believes that he can wait us out. So therefore, the war continues.”


6,961 posted on 10/06/2024 4:28:18 PM PDT by BeauBo
[ Post Reply | Private Reply | To 6958 | View Replies]

To: PIF; All

“Attack on Chinese nationals near Karachi airport leaves 2 dead, 10 injured”

“Pakistani separatist group BLA claimed responsibility, saying it had ‘targeted a high-level convoy of Chinese engineers and investors’”

https://www.scmp.com/news/asia/south-asia/article/3281300/attack-chinese-nationals-near-karachi-airport-leaves-1-dead-10-injured?module=top_story&pgtype=homepage


6,962 posted on 10/06/2024 6:49:53 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6961 | View Replies]

To: PIF; All

“Netherlands Delivers First Batch of F-16 Fighter Jets to Ukraine”

“For the first time, I can officially announce that the first Dutch F-16s have been delivered to Ukraine,” Defense Minister Ruben Brekelmans posted on social media site X on Sunday, without saying how many planes have been shipped to the war-torn nation.

The Dutch government had said it would send 24 F-16 fighter jets to Kyiv. The rest of the jets “will follow in the coming months,” Brekelmans said during a visit to Kharkiv and Kyiv. The Netherlands and Denmark have been leading the coalition to ship the fighter jets and train the Ukrainian pilots.

Ukraine is in its third year of war against Russia’s invasion, heading into a difficult winter with relentless aerial attacks by Kremlin forces destroying half of its energy infrastructure. Russian troops have also made grinding advances in Ukraine’s east, while Ukrainian troops face shortages of weapons and personnel.

On Thursday, former Dutch Prime Minister Mark Rutte met with Ukrainian President Volodymyr Zelenskiy in Kyiv and pledged increased military support in his first foreign visit as the new secretary general of the North Atlantic Treaty Organization.

The Dutch government also pledged to provide €400 million ($439 million) in drone aid to Kyiv. The Hague will send an undisclosed number of drones for reconnaissance, defense and attack, nearly half of which will be developed in the Netherlands, the defense ministry said in a statement on Sunday.


6,963 posted on 10/06/2024 8:41:04 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6962 | View Replies]

Russian Offensive Campaign Assessment, October 6, 2024

The Russian military command may not be willing or able to accept the current scale and rate of vehicle loss in the coming months and years given the constraints in Russia's defense industrial production, limits to Russia's Soviet-era vehicle stockpiles, and the Russian military's failure to achieve operationally significant territorial advances through mechanized maneuver. Russian forces expended a significant number of armored vehicles during the first weeks of their offensive effort to seize Avdiivka in October 2023 and later limited their armored vehicle usage while fighting within Avdiivka’s administrative boundaries.[3] Russian forces appear to have limited their armored vehicle use in the area immediately west of Avdiivka in recent months, although Russian forces have simultaneously intensified their offensive operations west and southwest of Donetsk city and frequently conduct largely unsuccessful platoon- and company-sized mechanized assaults in the area.[4] Russian forces have conducted several battalion-sized mechanized assaults in western Donetsk Oblast since July 2024, the majority of which resulted in significant armored vehicle losses in exchange for marginal territorial advances.[5] The commander of a Ukrainian bridge operating in the Donetsk direction recently reported that Russian forces are losing up to 90 percent of the vehicles used in mechanized assaults in the Donetsk direction.[6] The British International Institute for Strategic Studies (IISS) think tank previously estimated that Russian forces were losing over 3,000 armored fighting vehicles annually as of February 2024, although Russia's current rate of armored vehicle losses may be higher given that the X user's data notably does not account for Russian equipment losses throughout the entire frontline.[7] Russian forces have only advanced about 40 km in the Avdiivka/Pokrovsk operational direction since October 2023 and a loss of over five divisions’ worth of equipment for such tactical gains is not sustainable indefinitely without a fundamental shift in Russia‘s capability to resource its war.

Russian forces have likely accumulated a large amount of equipment for these assaults, although the medium- to long-term constraints of Russia's armored vehicle stocks and production rates alongside mounting equipment losses may force the Russian military to rethink the benefit of intensified mechanized activity in this sector over Russia's longer-term war effort in Ukraine.[8] The Russian military command's willingness to pursue limited tactical advances in exchange for significant armored vehicle losses will become increasingly costly as Russian forces burn through finite Soviet-era weapons and equipment stocks in the coming months and years.[9] Russia will likely struggle to adequately supply its units with materiel in the long term without transferring the Russian economy to a wartime footing and significantly increasing Russia's defense industrial production rates — a move that Russian President Vladimir Putin has sought to avoid thus far.[10]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-october-6-2024

6,964 posted on 10/07/2024 2:42:39 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6938 | View Replies]




6,965 posted on 10/07/2024 2:44:39 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6906 | View Replies]


6,966 posted on 10/07/2024 2:46:30 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6940 | View Replies]

To: BeauBo
Russia is running out of artillery:

Another Russian armored vehicle duct-taped with an anti-air gun has appeared, and this time they are using it as a mortar.

Let me say this again. They are using ANTI-AIR, as A MORTAR.

https://x.com/astraiaintel/status/1843171794196599149
30s video

6,967 posted on 10/07/2024 3:49:32 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6956 | View Replies]

To: SpeedyInTexas

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Tanks Unleashed! Ukrainians Cut Off Russian Bridgehead! ]


Today [ Oct 07 ], there are a lot of updates from the Bakhmut direction.

Here, in a daring push, Russian forces launched the canal-crossing operation to establish a critical bridgehead, threatening to penetrate the southern flank of Chasiv Yar. But in an unexpected turn, Ukrainian forces located the commander of the strike detachment, and successfully targeted him and his unit, crippling the Russian operation, and setting the stage for a decisive counterattack.

Previously, Russian assaults in a residential area of Chasiv Yar failed to make significant gains. In response, Russian forces shifted their focus to the less elevated, more open southern flank of the city. Their objective was to cross the canal to the south by using the forests for cover and establishing positions to take the town of Stupochky. Securing Stupochky would allow the Russians to expand their bridgehead and gather a larger assault force to attack Chasiv Yar from the south, bypassing costly frontal assaults across the canal, directly in front of the town.

This approach was chosen because the highway from Bakhmut to Ivanivske, and then the road to the canal through open fields, allow Russian mechanized assault platoons to move quickly, reducing the risk of being targeted by FPV drones.

Additionally, Bakhmut and its surrounding areas, including Ivanivske, are protected by a vast network of Russian electronic warfare systems, offering a relatively safer route for the assault.

Since the highway from Bakhmut to Ivanivske is short and the paved roads allow Russian armored vehicles to move quickly, they were able to deploy their assault units to Ivanivske in intermittent bursts within minutes, avoiding drone strikes.

Upon arrival, Russian stormtroopers dismounted and dispersed, using Ivanivske’s urban environment for cover. They then moved into the forests just south of the town, where they regrouped. Once gathered in the forests, the Russians decided to cross the canal via a ground crossing, as the two nearby bridges had been destroyed in fighting over a year ago.

With the entire area covered in forests, Russian forces crossed the canal undetected at night, establishing positions on the Ukrainian side. The dense forest cover made it difficult for the Ukrainians to spot the advancing Russians, who effectively concealed themselves. Shortly after, the Russians released footage showing their stormtroopers raising battle flags to mark their presence at the Stupochky bridgehead.

After realizing that the Russians started to push toward Stupochky, the Ukrainians swiftly organized a counterattack.

First of all, since the Russian forces had crossed the canal at night to enter the forests on the other side, the Ukrainians established total control over this section of the canal using FPV drones and ground forces. With all Russian troops positioned in the forests, this move undermined the connection to the Russian assault detachment near Stupochky, severing their supply lines for food and ammunition.

Secondly, by holding their positions on the opposite side of the canal, the Ukrainians were able to steadily build up their forces. While the Russians concentrated on advancing across the canal, the Ukrainians patiently assembled a decisive strike force.

This allowed them to launch a counterattack from the south, cutting off the Russian retreat route through the canal’s underground crossing. As a result, the Ukrainian forces effectively destroyed the Russian detachment and reclaimed the bridgehead.

During the operation, the commander of the Russian assault unit was reportedly killed, severely disrupting the organization and command of the Russian forces, effectively decapitating the assault itself.

Aware of Russian plans, the Ukrainian command reinforced their positions on their side of the canal, using the forest cover to their advantage. They fortified the area to ensure that any future Russian assaults would be very costly.

To further prevent any future Russian assaults, the Ukrainian Air Force deployed JDAM-guided bombs to strike a Russian ammunition depot in Bakhmut, putting additional pressure on Russian logistics.

These strikes are expected to cause immediate short-term ammunition shortages for Russian forces, which may take several days or even a week to replenish, further delaying their ability to launch future assaults.

Overall, Russians attempted to take advantage of the complicated Ukrainian defense south of Chasiv Yar, only for their entire assault group to get destroy after crossing the canal.

By maintaining a strong defense near the canal and reinforcing their defenses there, the Ukrainian successfully prevented Russians from having another chance at crossing the canal.

This issue will force the Russians to resort to their costly assaults in central Chasiv Yar which will continue to take a toll on their manpower resources for further assaults.


6,968 posted on 10/07/2024 5:36:34 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6963 | View Replies]

To: AdmSmith

Russia’s average daily casualties in September reached a new high of 1,271, according to UK Intelligence.

Every day.

The USA had 1,143 casualties in the whole Gulf War, including killed and wounded, combat and non-combat combined.

The scale of what Putin is doing to Russia is truly historic.


6,969 posted on 10/07/2024 5:55:46 AM PDT by BeauBo
[ Post Reply | Private Reply | To 6965 | View Replies]

To: PIF
A russian Lancet worth 150 russian senior citizen pension payments brought down by a simple drone

https://x.com/NAFORaccoon/status/1842888554147729580


6,970 posted on 10/07/2024 6:51:15 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 6968 | View Replies]

To: PIF; All

Second Army of the Universe

“Russian soldiers with scooters.”

https://x.com/RALee85/status/1843160674660384856


6,971 posted on 10/07/2024 7:00:19 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6970 | View Replies]

To: PIF; All
"The maritime oil terminal in Feodosia, located in occupied Crimea, is still burning after a night attack by the Ukrainian Armed Forces."




6,972 posted on 10/07/2024 7:07:03 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6971 | View Replies]

To: PIF; All

“Last night, in occupied Feodosia, drones hit not just a regular oil depot but an important transshipment hub for the Russians — an oil port that can receive tankers with oil products all year round, store them, and supply them throughout the occupied Crimea.

This is a serious blow to the logistics of the Russian troops if they fail to extinguish the fire and deal with the aftermath.”

https://x.com/wartranslated/status/1843224766078914904


6,973 posted on 10/07/2024 7:08:43 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6972 | View Replies]

To: SpeedyInTexas; BeauBo
Cluster munitions strike on the positions of a Russian 2S7 Pion 203mm self propelled howitzer. The strike was carried out just in the moment when supply truck was delivering artillery ammunition.

https://x.com/bayraktar_1love/status/1843253669732712776

It is clear in the video that the HIMARs rocket missed the target by over 15 feet due to ruzzian EW.

Unfortunately (for them), one bomblet hit the supply truck and BOOM!


6,974 posted on 10/07/2024 7:10:06 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 6972 | View Replies]

To: PIF; All

“The oil terminal in Feodosia, occupied Crimea, keeps burning hours after it was struck by Ukrainian drones/missiles.”

https://x.com/NOELreports/status/1843278009178202362


6,975 posted on 10/07/2024 7:10:07 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6973 | View Replies]

To: PIF; All

“The GUR successfully disabled another Russian warship. The Baltic Fleet minesweeper “Aleksandr Obukhov”, based in the city of Baltiysk, was damaged during a special operation. After water entered the engine, it’s now in for expensive and complex repairs. This is the 2nd Russian ship disabled by Ukraine in the past 6 months.”

https://x.com/NOELreports/status/1843274321281548329


6,976 posted on 10/07/2024 7:12:01 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6975 | View Replies]

To: PIF; All

“Ukraine will not extend the transit agreement with Russia after it expires [DEC 2024], says Shmyhal.

“We urge all of Europe to fully abandon Russian oil and gas,” the Ukrainian Prime Minister added.”

https://x.com/NOELreports/status/1843267261718831461


6,977 posted on 10/07/2024 7:14:53 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6976 | View Replies]

To: PIF; All
“The oil facility in Feodosia, occupied Crimea, which was attacked by Ukraine, reportedly by two missiles. Firefighters are struggling to put down the fire. Three people were reported injured. At this moment it is known that 5 fuel tanks were damaged and two were destroyed.”




6,978 posted on 10/07/2024 7:18:45 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6977 | View Replies]

To: PIF; All

“Ukrainian Defense Intelligence reports that Obukhov minesweeper of the Russian Baltic Fleet has been put out of order in a successful operation.

The ship was based in the city of Baltiysk and was supposed to go on combat duty. It suffered severe damage due to the mysterious appearance of a hole in the gas pipe. That led to water getting inside the engine.

Now it’s going in for a lengthy repair, which is going to be a problem for Russia as these engines are scarce.

Obukhov is the second Russian Baltic Fleet ship that has been damaged within the past six months.

Glory!”

https://x.com/Gerashchenko_en/status/1843272901929132397


6,979 posted on 10/07/2024 7:21:33 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6978 | View Replies]

To: PIF; All

“Oleg Tsarev, traitor of Ukraine, “politician” of the “DPR” and “LPR”, said that China is robbing Russia as it buys Russian energy with a heavy discount.”

https://x.com/Gerashchenko_en/status/1843261044057338037


6,980 posted on 10/07/2024 7:22:50 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6979 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 6,941-6,9606,961-6,9806,981-7,000 ... 19,361-19,372 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson