Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 6,621-6,6406,641-6,6606,661-6,680 ... 19,061-19,068 next last
To: PIF; All

Interesting

“Volodymyr Zelenskyy’s visit to the United States is being extended for another day. “


6,641 posted on 09/26/2024 2:55:46 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6640 | View Replies]

To: PIF; All

“The United Kingdom Ministry of Defense has announced that it will provide Ukraine with a batch of 155-mm AS-90 self-propelled artillery systems.

10 units have already been delivered to Ukraine and 6 more will arrive in the coming weeks.”

https://x.com/wartranslated/status/1839342975949901944


6,642 posted on 09/26/2024 2:56:55 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6641 | View Replies]

To: PIF; All

“Donald Trump just confirmed that he will be meeting President Zelenskyi tomorrow in his Trump tower.”


6,643 posted on 09/26/2024 3:01:28 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6642 | View Replies]

To: PIF; All

“A modified MT-LB with Grad launcher on top was destroyed once it returned into the hangar it came from.”

https://x.com/NOELreports/status/1839419040152125655


6,644 posted on 09/26/2024 3:12:41 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6643 | View Replies]

To: PIF; All

“Saudi Arabia is ready to abandon its unofficial price target of $100 a barrel for crude as it prepares to increase output, in a sign that the kingdom is resigned to a period of lower oil prices, according to people familiar with the country’s thinking.”

https://x.com/KevRGordon/status/1839260826168971693


6,645 posted on 09/26/2024 3:22:58 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6644 | View Replies]

To: PIF; All

This is going to hurt RuZZia.

“However, the kingdom has decided it is not willing to continue ceding market share to other producers, the people said. It also believes it has enough alternative funding options to weather a period of lower prices, such as tapping foreign exchange reserves or issuing sovereign debt, they added.”


6,646 posted on 09/26/2024 3:27:13 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6645 | View Replies]

To: PIF; All

Throwing Indicted War Criminal Little Pukin under the bus.

“Under the delayed plan to begin unwinding the cuts, Saudi Arabia will increase its monthly production by an additional 83,000 b/d each month from December, boosting its output by a total of 1mn b/d by December 2025.”


6,647 posted on 09/26/2024 3:28:47 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6646 | View Replies]

To: AdmSmith

Israel is handling it, Iran is messing with fire.


6,648 posted on 09/26/2024 5:36:22 PM PDT by blitz128
[ Post Reply | Private Reply | To 6635 | View Replies]

To: SpeedyInTexas

“Throwing Indicted War Criminal Little Pukin under the bus.
(Saudi Arabia will increase its monthly production)”

Iran too. Under the bus they go.

It was too much to ask Saudi Arabia to take years of low oil prices to hurt Russia’s war effort. But when Russia is at the end of its rope, after its reserves are depleted, they could push them over the edge (for their buddies King Donald and Prince Jared).

Oil is not just a weapon for Putin.


6,649 posted on 09/26/2024 6:50:47 PM PDT by BeauBo
[ Post Reply | Private Reply | To 6647 | View Replies]

Russian Offensive Campaign Assessment, September 26, 2024

The Russian Federal Security Service (FSB) is reportedly struggling to coordinate combat tasks with the Russian military despite having control over the counterterrorism operation against the Ukrainian incursion in Kursk Oblast. Russian exiled opposition outlet Novaya Gazeta Europe reported on September 25 that it identified an FSB Spetsnaz servicemember who died fighting in Kursk Oblast in August 2024 — confirming that elements of FSB Spetsnaz are fighting in Kursk Oblast.[6] Novaya Gazeta Europe reported that an FSB officer stated that the FSB has tasked FSB Spetsnaz, including elements of the Alpha and Vympel groups, with identifying and destroying Ukrainian sabotage and reconnaissance groups in Kursk Oblast.[7] The FSB officer reportedly stated that the Alpha and Vympel groups are ill-suited for combined arms battles involving heavy equipment against regular military forces, however.[8] FSB Spetsnaz has typically conducted counterterrorism operations against small terrorist groups and likely lacks the training and equipment needed to respond to Ukrainian units conducting combined arms assaults. Another source close to Russian special services reportedly told Novaya Gazeta Europe that the FSB’s Special Operations Center does not have a “common connection” with Russian military units and that there is still no common headquarters for coordinating combat tasks between the FSB and the Russian military.[9] Putin tasked the FSB with conducting a counterterrorism operation in Belgorod, Bryansk, and Kursk oblasts on August 9 following the start of the Ukrainian incursion into Kursk Oblast on August 6, but then proceeded to assign overlapping tasks to the Russian Ministry of Defense (MoD), FSB, and Rosgvardia.[10] The Kremlin and the Russian military command have struggled to establish a cohesive and effective command and control (C2) structure during the response to the Ukrainian incursion in Kursk Oblast, and it remains unclear what responsibilities fall under the purview of the FSB’s counterterrorism operation or the MoD’s Coordination Council.[11] ISW has previously assessed that overlapping tasks and poor C2 structures will likely continue to generate friction between the FSB and the Russian MoD.[12]

more + maps https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-september-26-2024

6,650 posted on 09/26/2024 10:21:08 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6635 | View Replies]


6,651 posted on 09/27/2024 12:22:57 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6636 | View Replies]

To: SpeedyInTexas

China’s PLARF launches an ICBM 7,145 miles into the Pacific - the first time since 1980. Used either the DF-31 of DF-41 road-mobile missile. Both can hit anywhere in the US from the new missile silo field in Ordos, China.

First Chinese ICBM Test Into The Pacific In Decades Is A Big Deal (Updated)
China last fired an intercontinental ballistic missile into the Pacific in 1980 and its latest launch highlights its rapidly evolving nuclear posture.
https://www.twz.com/nuclear/first-chinese-icbm-test-into-the-pacific-in-decades-is-a-big-deal


6,652 posted on 09/27/2024 4:52:20 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6647 | View Replies]

To: SpeedyInTexas

Biden Surging $8B In Aid To Ukraine That Includes AGM-154 Joint Standoff Weapons For F-16s
The new package that will give Ukraine’s F-16s standoff strike capabilities was announced while President Zelensky is visiting the U.S. Capital.
https://www.twz.com/news-features/biden-surging-8b-in-aid-to-ukraine-that-includes-agm-154-joint-standoff-weapons-for-f-16s


6,653 posted on 09/27/2024 4:53:57 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6647 | View Replies]

To: SpeedyInTexas

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Defense on The Brink! Russians Close in. Ukrainians Fight For Survival ]


Today [ Sept 27 ], there are a lot of updates from the Kurakhove direction.

The intensity of Russian assaults in the area of Vuhledar increased significantly, with Russian advances on the flanks of the city while the Ukrainians successfully repelled direct frontal assaults. The situation in the Vuhledar area is becoming more complex and dynamic for the Ukrainian defenders as Russians are once again trying to assault the city for the third time in the war.

One of the main vectors of the Russian assault was aimed directly at Vuhledar from the south. This direction posed significant risks for Russian stormtroopers and armored vehicles, as the vast fields surrounding the city made them easy targets for Ukrainian forces stationed in the high-rise buildings. Despite this, the Russian command proceeded with its preparations, gathering forces in Pavlivka, south of Vuhledar.

Combat footage from Ukrainian drone operators of the 72nd Motorized Brigade shows them spotting a group of Russian stormtroopers on motorcycles heading to an assembly point in Pavlivka. The Ukrainian drones then struck, destroying the Russian forces and halting the assault before it could begin.

In the eastern part of Vuhledar, the situation remains more fluid. Russian forces previously seized control of the high-rise buildings at the South-Donbass Number One Coal Mine complex, using the area as a staging ground for assaults on Vuhledar from the east. Additionally, the high-rise buildings in Vuhledar, where Ukrainian firing positions are concentrated, face the plains to the south toward Pavlivka.

This positioning makes Russian assaults from the road east of the coal mine safer, as they are less exposed to Ukrainian fire. In preparation for these assaults, Russian artillery heavily bombarded the city with Tornado-S rocket systems, attempting to weaken Ukrainian defenses ahead of a full-scale ground assault to capture the town.

However, geolocated footage reveals that after several ground assaults, only a small number of Russian stormtroopers managed to enter the city and take positions in nearby buildings. According to Ukrainian fighters, due to the limited number of Russian troops in the area, they are unlikely to hold these positions for long and will likely be driven out by Ukrainian forces inside Vuhledar.

To the north of Vuhledar, the situation is far more complex. Russian stormtroopers previously captured Vodiane, after suffering heavy casualties during their assaults. Following this, Russian command quickly decided to advance toward the South-Donbass Coal Mine Number Three. Combat footage from the area shows intense Russian artillery fire targeting the coal mine to suppress Ukrainian positions. Once the barrage ended, a platoon-sized mechanized assault force moved across the fields between Vodiane and the coal mine.

With Ukrainian positions still suppressed, the Russian infantry dismounted upon entering the coal mine complex and immediately opened fire. Following this, the Russian command sent another mechanized platoon to reinforce the assault on the coal mine, again taking advantage of the success of the heavy artillery fire, which kept Ukrainian troops in shelters. Although the Russian forces initially failed to fully capture the coal mine, the Ukrainian troops chose to withdraw to more defensible positions.

Before retreating, the Ukrainians demolished the high-rise towers of Coal Mine Number Three, preventing the Russians from gaining fire control over the surrounding areas and diminishing the mine’s tactical value.

To the west of Vuhledar, near Prechistivka, Russian forces are concentrating efforts to cross the Kashlahach River and use the bridgehead to encircle Vuhledar and advance toward the Berestova gully. Combat footage shows Russian stormtroopers from the 40th Marine Brigade dismounting from armored transports and storming Ukrainian trenches in assault squads of 8 troops each.

The intensity of the Russian assaults in this area has expanded their bridgehead across the Kashlahach River, bringing them dangerously close to Vuhledar and rendering one of the main Ukrainian supply roads unusable due to physical Russian control of it.

The potential for Russian fire control over supply routes is a major concern for the several hundred Ukrainian troops in the town, primarily from the elite 72nd mechanized Brigade.

Russian positions north of Prechistivka combined with strong firing positions at the turakon of the South Donbas Mine Number One, have effectively trapped Ukrainian forces in a cauldron where all critical supply roads are visible and vulnerable to Russian artillery and drone strikes.

If Ukrainian forces can push the Russians back from the open fields closer to Prechistivka they could significantly reduce Russian pressure on the logistical routs to Vuhledar this would help the Ukrainians maintain their position in the city. However, if the situation continues to deteriorate, they may be forced to withdraw to more secure positions in Novoukrainka to the north.

However, the potential withdrawal of Ukrainian forces from Vuhledar is not as critical as media portrayals suggest. The next Ukrainian stronghold is Novoukrainka and a withdrawal to the settlement would stabilize the situation, even if Vuhledar falls, limiting the Russian advance to around 5km.

If we look at the topographic map, we can see that Novoukrainka sits on the same hill ridge as Vuhledar, offering similar geographic and tactical advantages. Thus, the Russian advance from Vodyane would likely be halted at Bohoyavlenka while their advance from the south and east would be stopped at Novoukrainka.

Additionally, the upcoming rainy season, expected in a few weeks, will make it easier for Ukrainian forces to repel further Russian advances. The imminent mud season is actually the prime reason why Russians push in this direction, no matter the cost, they understand that if they fail to secure these gains now, then their whole summer campaign would be rendered useless.

To slow down Russian assaults around Vuhledar, Ukrainian forces launched missile strikes on the largest Russian ammunition warehouses in Mariupol. Satellite footage revealed the aftermath, showing fires and explosions on the outskirts of the city

Ukrainian rocket artillery successfully struck the targets and favorable winds made the widespread damage visible. Images from the site show the extensive destruction of the Russian ammo storage, where nearly everything was obliterated.

Overall, the Ukrainians are engaged in the most intense battle for Vuhledar ,since the start of fighting in this area, and while they successfully prevent and defeat Russian frontal assaults, the Russian flank assaults risk placing Ukrainians in a cauldron. Ukrainian forces could maintain stable control of Vuhledar or withdraw depending on the outcome of further fighting.

As a precautionary measure in case they withdraw, the Ukrainian command prepared to fortify and withdraw defenders of Vuhledar to Novoukrainka, which has the topographic and defense features to become the second Vuhledar, and prevent any further frontline collapse.


6,654 posted on 09/27/2024 5:35:14 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6647 | View Replies]

To: PIF; All

“ Prime Minister Viktor Orban distanced himself from a top adviser who asserted that Hungary would have surrendered to invading Russian troops if it were in Ukraine’s position two years ago.

Balazs Orban, the premier’s political director said late Wednesday that Ukraine’s defense against the invasion was “irresponsible” — and signaled that Hungary, a NATO member, would not have put up a fight, as he cited parallels with the country’s failed 1956 anti-Soviet uprising.”


6,655 posted on 09/27/2024 5:52:06 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6654 | View Replies]

To: PIF; All

5 million barrels…

“ The U.S. benchmark West Texas Intermediate is down nearly 6% this week, while global benchmark Brent has pulled back nearly 4%. Prices have fallen even as conflict in the Middle East escalates, with Israel and Hezbollah trading blows in Lebanon.”

“ There’s still over 5 million barrels a day of shut in capacity in the Middle East,” Yergin said”

https://www.cnbc.com/2024/09/27/crude-oil-prices-today.html


6,656 posted on 09/27/2024 6:00:46 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6655 | View Replies]

To: SpeedyInTexas

Furries to the Front !!

Kremlin snuff box, 09/26/24
https://t.me/s/kremlin_secrets

They want to send quad players to the SVO area

This proposal was made to Vladimir Putin personally by a number of advisers, deputies and Defense Ministry officials. Let us remember that the subculture of quadrobers [ Furries ] ( whose representatives imitate the behavior of animals and move on all fours ) was even proposed to be banned in Russia. But perhaps they will find other uses.

“All these people, mostly young, will be very useful at the front. There, the ability to move on all fours will come in handy, as well as cat habits, and much more. Moreover, I would send people of both sexes there. Girls, for example, could help wounded soldiers.

“Look, we’ll avoid mobilization this way. We’ll take a quadrober into the army, and then some other punk or other pervert. And I’m not joking now!” - one of the initiators of this proposal, a State Duma deputy from United Russia, told us.

According to him, the proposal was personally supported by Andrei Belousov. “The minister, when he was offered to send these beast people to the Northern Military District zone, said that people are needed at the front, and society will become more normal, if there are fewer such strange subjects in it,” the source claims.

The President, as far as we know, has not yet responded to this initiative.


6,657 posted on 09/27/2024 6:52:13 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6656 | View Replies]

To: SpeedyInTexas

On Nuclear War


Kremlin snuff box, 09/26/24
https://t.me/s/kremlin_secrets

“Not this year.” Are we ready for a nuclear strike?

The update of the fundamentals of state policy in the field of nuclear deterrence and important statements by Vladimir Putin on the use of nuclear weapons have raised many questions. We answer the main ones.

Why were such statements made right now? The problem is the behavior of NATO countries, which are increasing support for the Kyiv regime. “We know that NATO is cowardly ( note that sometimes this bet works, sometimes it doesn’t - ed. ). And they will no doubt be scared. Therefore, Vladimir Vladimirovich made a great move. I want all Russians to know this and be proud of our President,” a Kremlin source told us.

Regarding the possible use of nuclear weapons, he did not give a direct answer. He only noted that “no one wants to see Moscow burning, so everything is clear here.”

Can we use nuclear weapons if our military installations are attacked? Here, let’s say right away, the answer from the interlocutor at the Ministry of Defense unpleasantly surprised us.

“Let’s be honest. Nobody wants to die for Toropets or Morozovsk. Nobody even wants to die for the city of Russian glory, Sevastopol. Look, they hit him with NATO missiles, so what? Then think for yourself,” the military man said sadly.

This position, we repeat, surprised us a little. But we simply had to publish it.

When is it possible for us to use nuclear weapons? Here the sources avoided a direct answer. “Definitely not this year. It’s unlikely that we will fight directly with NATO this year ( our interlocutor confirmed our insight on the topic of a big war with the West - ed. ). This means that there is no need to use nuclear weapons yet,” said an interlocutor close to Vladimir Putin.

How did the elites perceive the President’s new nuclear rhetoric? In general, it was received positively. Many praise Vladimir Vladimirovich for his strong step and believe that he, we quote, “firmly took NATO in one place [ put NATO in its place ].” But there are also dissatisfied people.

“Honestly, I am now afraid of being burned in a nuclear fire along with my entire family,” a general who belongs to such a minority complained to us. In addition, according to the military man, given the unsuccessful test of the Sarmat missile, the President’s words may not be taken seriously.

Let us note on our own: it is good that there are not so many such assessments now.


6,658 posted on 09/27/2024 6:59:23 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6656 | View Replies]

To: SpeedyInTexas
A Russian 2S5 Giatsint-S self-propelled howitzer was hit by an FPV drone, causing its ammunition to detonate. The strike was carried out by the "Achilles" unit from the 92nd Assault Brigade.

https://x.com/NOELreports/status/1839354329104552160

This is significant because self-propelled howitzers are usually located well behind the front...out of range of most FPV drones.


6,659 posted on 09/27/2024 7:19:57 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 6656 | View Replies]

To: SpeedyInTexas

OT:
It is now turning out that not only do we not know Kamala’s policies and her positions, but also that we do not know who she is.

SHOCK: Candace Owens Takes a Deep Dive Into Kamala’s Geneology - It’s Not What We’ve Been Told
https://rumble.com/v5giwcb-shock-candace-owens-takes-a-deep-dive-into-kamalas-geneology-its-not-what-w.html


Owen turns up that Harris’ grandmother was white. Donald Harris’s story about his descent is full of obvious holes and omissions. He is not to be trusted, having omitted 2 significant marriages.

Side by side of “Miss Iris” and K revels they both have similar smiles, cheekbone and facial structure.

Kamala may have appropriated their domestic help as her grandmother, and if true, “this is one of the most diabolic political moves we have ever seen in the history of this country”.

The dog that isn’t barking - the omitted marriages, the laughing-out-of-the-room at the mention that Kamala is white

Owen is not going to let go of this, she said.


There is enough genealogy included in the video that one could go on My Heritage or Ancestry and track the family history for one’s self.


6,660 posted on 09/27/2024 8:21:16 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6656 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 6,621-6,6406,641-6,6606,661-6,680 ... 19,061-19,068 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson