Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 6,261-6,2806,281-6,3006,301-6,320 ... 19,361-19,369 next last
To: PIF; All

“How a U.S. spy tapped into Russian communication lines”

“In the late 1970s, American spy Jim Olson was stationed in Moscow. At the time, it was one of the riskiest and highest-stakes CIA stations in the world.

Olson, who served more than 30 years overseas, had been intercepting sensitive Russian information that was being sent over microwave transmissions. He knew that, if they were caught, it could mean spending the rest of their lives in a Soviet prison.

Many of the transmissions dealt with military and defense information, and they eventually discovered their tactic of intercepting these messages was under threat. Something more secure was in the works for the Russians: their communications were going underground.

“We know exactly what they’re doing,” Olson told CNBC Senior Washington Correspondent Eamon Javers on the latest episode of CNBC’s new original podcast series “The Crimes of Putin’s Trader.”

For this series, Eamon Javers spent nearly a year investigating a criminal network and exploring how wealthy Russian hackers stole millions from U.S. investors. Javers interviewed FBI agents, prosecutors — and even spies like Olson — to reveal the shocking details of a massive criminal enterprise.

In episode six, Javers talks with Olson, who details his dangerous mission to retain a crucial well of information. After satellite images confirmed the Russians had already started digging the tunnels for the cable, the CIA operatives knew they had to do something quickly – before the well ran dry.

“We decided to go after it,” he said.

Olson and two other operatives were designated for assignment in Moscow and trained on how to tap into those cables (and how to do it covertly).

But that mission wasn’t easy: Olson had to disguise himself as a Russian peasant, taking a public bus out to the countryside on a route often patrolled by militia. He broke into a manhole on the side of a highway, monitored for potential poisonous gas (or Russian police) in the tunnel and lowered himself into the shadows.

Javers asked Olson what it feels like to go on such a mission, something he called “Mission Impossible stuff.” He asked if fear ever entered his mind.

“Fear doesn’t enter into it because you are so mission-focused,” Olson said. “We just do what we’re trained to do and it’s a great sense of accomplishment when you carry something out like that.”

For spies like Olson who put their lives on the line, motivation is everything.

“It’s humbling because you have this sense that your country put that much trust in you to carry out that mission,” Olson said. “And that you can make a significant contribution to our country’s security – it’s pretty heavy stuff.” “

https://www.cnbc.com/2024/09/13/how-a-us-spy-tapped-into-russian-communication-lines.html


6,281 posted on 09/13/2024 8:10:35 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6280 | View Replies]

To: PIF; All

“China’s ‘conscientious economist’ goes viral by speaking the truth”

“Straightforward and critical remarks by Northeast Securities’ chief economist Fu Peng on China’s economy have gone viral on Chinese social media”

“An outspoken economist has gone viral on Chinese social media as his down-to-earth comments about China’s slowing economy struck a chord with the general public.”

“Fu Peng, chief economist at brokerage firm Northeast Securities, addressed a slew of issues, including the stock market slump and the real estate crisis, at the 2024 Phoenix Financial Forum for the Greater Bay Area at the start of September.

His straightforward and critical remarks, with Fu having previously only attracted attention within financial circles, quickly circulated across online communities.

Widely shared comments include his vivid illustration of the concept of a middle-class consumption downgrade, by linking consumers’ choice of coffee to the shrinking property market.

“Once property values drop, consumer spending falls rapidly, with middle-class buyers shifting from 40 yuan coffees to 8 yuan ‘buy one, get one free’ deals,” he said at the event, organised by ifeng, a news portal under Hong Kong’s Phoenix TV.”

““The situation in Japan back then is basically the same as what we are experiencing now,” he noted in the speech, which had attracted over 162,000 views by Friday afternoon on Bilibili, a popular video-sharing app known for its anime content.

During the 22-minute speech, Fu also analysed other issues, including population ageing, weak demand, low confidence reflected in a stagnant stock market and declining investment returns.”

“In another video shared on Weibo by ifeng on Wednesday, Fu’s comment about how real estate had become no longer investible and instead something to consume that required an annual maintenance cost equal to 2 per cent of the total price had received 2 million views.”

““With half of my stock investment lost and housing prices down by 30 per cent, and still having to repay loans, how can ordinary people like us dare to consume?” the user said.”

“Bearish assessments of the Chinese economy and the government’s policies have become sensitive content in China in the past year.

At an annual economic work conference in December, officials were instructed to play up a bright view of the Chinese economy and step up public relations campaigns to lift confidence.”

https://archive.ph/SdlRR


6,282 posted on 09/13/2024 8:22:46 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6281 | View Replies]

To: SpeedyInTexas

Me Strooooong Pooooowerful Leader looks AI generated


6,283 posted on 09/13/2024 8:58:22 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6278 | View Replies]

To: SpeedyInTexas; PIF
The real stuff


6,284 posted on 09/13/2024 9:48:23 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6278 | View Replies]

To: AdmSmith
Even better real stuff.

240217-wn-wang-zelensky-hp-Main-16x9
6,285 posted on 09/13/2024 9:55:16 AM PDT by ANKE69 ( ✌️ 🇺🇲 )
[ Post Reply | Private Reply | To 6284 | View Replies]

To: PIF; All

Broken Thru

“Warriors of the 95th Air Assault Brigade lit up a Russian T-90 tank in Kursk Oblast.”

https://x.com/wartranslated/status/1834644036638196223


6,286 posted on 09/13/2024 11:01:53 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6285 | View Replies]

To: PIF; All

Just Warms the Heart

“”The lion’s share of the seriously wounded on the battlefield die before hospitalization. They do nothing! Morons! Bastards! Thieves!”

Angry Russian patriot Yuri Yevich shares about the catastrophic state of tactical medicine in Russia, due to which many wounded people do not even make it to hospitals. He blames the Russian ministry of defense and everyone who is responsible for this.”

https://x.com/Gerashchenko_en/status/1834610329017266579


6,287 posted on 09/13/2024 11:06:33 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6286 | View Replies]

To: PIF; All

“Ukrainian FGM-148 Javelin hits a Russian tank, reportedly in the Kursk region.”

https://x.com/NOELreports/status/1834697892264919538


6,288 posted on 09/13/2024 2:54:11 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6287 | View Replies]

To: PIF; All
Towed artillery. Cranking through Soviet storage.




6,289 posted on 09/13/2024 3:00:02 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6288 | View Replies]

To: PIF; All

“Vance Describes Plan to End Ukraine War That Sounds a Lot Like Putin’s”

https://www.nytimes.com/2024/09/13/us/politics/vance-trump-ukraine-russia-war.html


6,290 posted on 09/13/2024 5:51:28 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6289 | View Replies]

To: SpeedyInTexas; AdmSmith; blitz128; PIF; BeauBo; FtrPilot; Monterrosa-24; USA-FRANCE; ...

Here at Free Republic, I wonder how this “surrender your invaded territory” to Russia by VP candidate Vance will affect the Trump vote in November? What has happened to Republicans that they are willing to give up their friends and supporters to keep dictators from waging war and even believe it would work?


6,291 posted on 09/13/2024 10:40:57 PM PDT by gleeaikin ( Question authority as you provide links)
[ Post Reply | Private Reply | To 6277 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, September 13, 2024

Russia continues efforts to strengthen strategic military ties with the People's Republic of China (PRC), North Korea, and Iran to support its war effort in Ukraine. Russian Deputy Defense Minister Alexander Fomin traveled to Beijing on September 13 to partake in the Xiangshan Forum where he highlighted the deepening strategic partnership between Russia and the PRC.[25] Fomin emphasized Russian-PRC plans for over 100 joint military cooperation events in 2024, blamed NATO and the US for intensifying the war in Ukraine, and criticized the US for pursuing an alleged dual containment policy of Russia and the PRC.[26]

Reuters, citing two undisclosed European intelligence sources and obtained documents, reported on September 13 that Russia has been producing the long-range “Garpiya-A1” attack drone using Chinese engines and other dual-use parts since 2023 and that Russian forces have used the drone to strike military and civilian targets in Ukraine.[27] The Garpiya-A1 drone has a range of 1,500 kilometers, similar to the Iranian Shahed-136 drones. Reuters reported that Russian weapons manufacturer IEMZ Kupol reportedly produced over 2,500 Garpiya-A1 drones between July 2023 to July 2024.

TASS also reported on September 13 that Russian Security Council head Sergei Shoigu traveled to Pyongyang, North Korea and met North Korean President Kim Jong Un for unspecified bilateral discussions.[28] This follows Russian President Vladimir Putin's visit to North Korea in June 2024, where he signed a Comprehensive Strategic Partnership agreement with Kim and continued shipments of North Korean artillery shells and ballistic missiles to Russia.[29] Shoigu’s visit also follows Iran's recent delivery of over 200 Fateh-360 short-range ballistic missiles to Russia and Putin's meeting with Iranian Secretary of the National Security Council, Ali Akbar Ahmadian on September 12.[30]

Russia's deepening engagement with the PRC, North Korea, and Iran is part of a wider Kremlin effort to establish a coalition of friendly states aimed directly at enhancing the Russian defense industrial base (DIB) and securing strategic economic cooperation to support its war in Ukraine.[31]

more + maps https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-september-13-2024

6,292 posted on 09/14/2024 12:41:54 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6252 | View Replies]

To: blitz128; PIF; SpeedyInTexas
Russian blogger:
Nabiullina made a knight's move, but it could get even worse

The Central Bank of Russia raised the key rate to 19%. Step by step, the Central Bank is moving towards the 20% figure, which was set after the start of the SVO in 2022. The head of the Central Bank, Elvira Nabiullina, is trying to keep money within the system. However, this also indicates an acceleration in inflation. “Nabiullina was tasked with attracting money to deposits. They say that the issue of raising the rate to 20% was considered, but for now they decided to raise it to 19%,” said a government source.

At the same time, according to him, the country is seeing an increase in non-performing loans. This is another incentive to raise the rate. In general, as another source says, the authorities have to “print” more money than previously predicted.

“A great many payments are connected with the SVO. These include high salaries for the military, and “lifting” bonuses when signing a contract , and “grave” bonuses. All of this needs to be paid for, it is a huge sum of money,” said our source familiar with the real macroeconomic indicators. We asked Anatoly Chubais to comment on what is happening in the Russian economy. “Elvira Sakhipzadovna is doing a very good job of her duties. Let's be honest, she and several other people play a key role in the stability of the system. In the conditions of war and sanctions. She is one of the few who can personally appeal to the president at any time. He also understands her role,” said Chubais.

He emphasized that the costs of conducting military operations are really serious. “In three years, we will be horrified by the state of the Russian economy. If the SVO [=invasion of Ukraine] does not end, then Russia will face very difficult times. And even Nabiullina will not be able to do anything. The number of mistakes made will be critical,” said Chubais.

https://t.me/kremlin_secrets/4646

Financial meltdown is coming.

6,293 posted on 09/14/2024 12:54:00 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6262 | View Replies]


6,294 posted on 09/14/2024 12:56:08 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6254 | View Replies]

To: gleeaikin

Its the same great idea that brought you North and South Korea, that saw Germany partitioned

A political decision with other people’s lives by uninvolved politicians, said to increase their standing with some segment of their constituents.


6,295 posted on 09/14/2024 3:40:38 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6291 | View Replies]

To: SpeedyInTexas

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Strategic Success! Ukrainians Force Russians Sacrifice The Pokrovsk Offensive ]


Today [ Sept 14 ], there are a lot of important updates from the Kursk direction.

Here, in a critical turning point, Ukrainian forces finally managed to escalate the pressure in the Kursk region to such an extent that the Russians were forced to sacrifice their Pokrovsk offensive and redeploy their most critical reserves to the north. By disrupting the biggest Russian offensive operation, on which Russians staked everything, the Ukrainian Kursk offensive proved to be a strategic success.

In the Korenevo area, Ukrainian forces significantly outnumbered the Russian defenders of the town and its surroundings. As the Russians lost substantial territory on the northern and southern flanks, Korenevo faced an imminent threat of encirclement. Russian forces anticipated Ukrainian attacks from Snagost and Krasnoktyabrske to the south, as well as from the railway embankment to the north, where the Ukrainians held strong positions that could serve as a base for further assaults.

As a result, the Russian command has been gradually redeploying troops to bolster their defenses in Kursk, forces initially intended to support the offensive in Pokrovsk. This shift is crucial because drawing Russian forces away from Pokrovsk was the primary Ukrainian strategic objective and the aim of the Kursk offensive.

Consequently, the Russian command sought to avoid deploying reserves from Pokrovsk at all costs. They redeployed troops from various parts of the frontline, including Chasiv Yar, but avoided drawing from Pokrovsk to maintain their momentum.

However, the worsening situation in and around Korenevo, coupled with the risk of encirclement by Ukrainian forces - which would open a route to Glushkovo - necessitated further redeployment of forces and equipment to alleviate the pressure. That is why the Russians were eventually compelled to redeploy troops from Pokrovsk as well.

According to Russian sources, this included elements from the 15th Motorized Rifle Brigade and the 1st Sloviansk Brigade. After accumulating forces, Russians even started launching counterattacks around Korenevo. The goal of these counterattacks is to remove the Ukrainian pressure on the town from the southern flank. The first wave of counterattacks comprised 8 armored vehicles and at least 70 soldiers.

Geolocated footage from the area shows the assault group advancing on the road from Korenevo to Snagost. Upon entering the village, they faced fierce resistance from Ukrainian fighters defending their positions. The Russian BMPs fired from their auto cannons to provide cover for the dismounting infantry.

The Russians would not be able to sustain such counterattacks without a substantial increase in available troops in the region. Ukrainian Commander-in-Chief Oleksandr Syrsky stated that the Russians redeployed up to 30,000 troops from unspecified directions to Kursk.

Meanwhile, President Volodymyr Zelensky stated that there are up to 60,000 Russian troops across the northeastern border from Bryansk to Kharkiv, including Kursk. Syrsky also noted that the number of troops, initially at 30,000, is expected to rise as the Russians plan further counteroffensive efforts in the Kursk region.

By forcing the Russians to deploy a significant number of reserves to Kursk, the Ukrainian command was able to alter the war’s trajectory. The diversion of most Russian reserves to the Kursk region led to a slowdown in the Pokrovsk offensive due to inadequate reserves, which were unable to replace heavy losses and maintain the previous operational tempo.

Therefore, Ukrainian forces managed to stabilize the Pokrovsk front and even begin pushing the Russians back around New York and Selydove, once the most critical and dynamic parts of the front. This success achieved the primary goal of the Kursk incursion: undermining the Russians’ theater-wide initiative.

But this was just the beginning of the bad news for the Russians. The large deployment of Russian reserves to Kursk, forced the Russian Northern Command to quickly establish logistics hubs, including ammunition and fuel depots, in Belgorod and Voronezh to support the counterattacks.

Ukrainian military Intelligence tracked the increased movement of Russian forces and identified the location of an ammunition depot in the town of Soldatski in the Voronezh region, where they conducted a powerful strike. Footage from the town shows massive fires and smoke, resulting from the powerful detonations of Russian ammunition and equipment stored there.

Lieutenant Andre Kovalenko, head of the Ukrainian Center for Countering Disinformation, stated that the Ukrainian drone strike successfully destroyed North Korean provided K-23 ballistic missiles at the ammunition depot in Soldatski.

Moreover, in the Belgorod region Ukrainians successfully struck and destroyed several fuel depots in the cities of Nikolski and Volovskirayon. This claim was later confirmed by footage from the area which showed the fires at the fuel storage sites.

Ukrainian drone strikes against the Russian rear and logistics hubs involved in the Kursk operation, are expected to further prolong the Russian counterattacks, which are predicted to continue for months.

Overall, the force redeployment of Russian reserves from Pokrovsk to Kursk, highlights the effectiveness of Ukraine’s strategic planning and the ability and perseverance to make such plans succeed.

The successful exploitation of key Russian vulnerability, allowed Ukrainians to completely alter the dynamics of the battles in the Ukrainian theater of war challenged the battlefield initiative and impose their own rules of engagement.

Remarkably Ukrainian forces achieved this in just 6 weeks, results that Russian offensives typically take 6 to 9 months to accomplish.


6,296 posted on 09/14/2024 4:07:55 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6251 | View Replies]

To: FtrPilot

Russian Su-30SM Flanker Crashes In Black Sea, Ukraine Says They Shot It Down With MANPADS
Ukrainian claims its special forces brought down the Russian multirole fighter using a shoulder-launched surface-to-air missile.
https://www.twz.com/air/russian-su-30sm-flanker-crashes-in-black-sea-ukraine-says-they-shot-it-down-with-manpads


6,297 posted on 09/14/2024 4:10:36 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6186 | View Replies]

To: SpeedyInTexas

Interesting articles:
Russia’s Kursk Counteroffensive Fully Underway
After more than a month, Russia has finally launched a major effort to kick Ukraine out of the Kursk region.
https://www.twz.com/news-features/russias-kursk-counteroffensive-fully-underway


Russia Now Using Thermite-Spewing ‘Dragon Drones’ To Torch Ukrainian Positions
A week after video first emerged of Ukraine’s thermite-spewing drones Russia is now using a similar incendiary weapon.
https://www.twz.com/news-features/russia-now-using-thermite-spewing-dragon-drones-to-torch-ukrainian-positions


Russia Covering Aircraft With Tires Is About Confusing Image-Matching Missile Seekers U.S. Military Confirms
Russia’s efforts to befuddle cruise missiles and drones with imaging-matching seeker capabilities speaks to issues that go beyond the war in Ukraine.
https://www.twz.com/air/russia-covering-its-aircraft-in-tires-is-about-befuddling-image-matching-seekers-u-s-military-confirms


Israeli Commando Raid In Syria Sends A Message To Iran That Its Underground Bases Are Not Untouchable
The raid targeted a deep underground Iranian weapons facility and included grabbing large amounts of intelligence before blowing it up using planted charges.
https://www.twz.com/news-features/israeli-commando-raid-in-syria-sends-a-message-to-iran-that-its-on-underground-bases-are-not-untouchable


6,298 posted on 09/14/2024 4:12:53 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6251 | View Replies]

To: PIF; SpeedyInTexas
Russian Su-30SM Flanker Crashes In Black Sea, Ukraine Says They Shot It Down With MANPADS

At this point, both sides agree that a Su-30M crashed in the Black Sea.

My guess is that UKF did not actually shoot the aircraft down with MANPADs.

Ukraine is simply feeding false flag information to confuse the ruzzians.

The video at the link below is inconclusive...multiple IIR videos edited together.

https://x.com/RALee85/status/1834105928502710666


6,299 posted on 09/14/2024 6:38:04 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 6297 | View Replies]

To: PIF
Russian forces using IFVs tried to take the village Liubimovka, Kursk region, in Russia and for a moment entered it from west / northwest. The usage of BMDs suggest that this were Russian VDV units of the 51st airborne regiment, so one of the “elite” Russian units. Yet, partially, they used the main road coming from Snagost, where one BMD gets torn apart by a mine (beginning of the video).

It ends with heavy Russian casualties comprised of at least five BMDs being destroyed and unknown number of troops eliminated. The embattled Russian village itself takes a heavy beating.

For better orientation I added a map.

https://x.com/Tendar/status/1834946249436356833

Video at the link above.


6,300 posted on 09/14/2024 6:46:57 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 6299 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 6,261-6,2806,281-6,3006,301-6,320 ... 19,361-19,369 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson