Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 6,061-6,0806,081-6,1006,101-6,120 ... 19,361-19,371 next last
To: PIF; All

“Senior defense source tells @N12News:
1. Israel moving closer to military campaign in Lebanon, exact date not decided yet; war with Hezbollah to erupt quickly if there’s no ceasefire deal.
2. IDF completing final preparation for war, including extensive prep for ground maneuvers.”

https://x.com/IsraelRadar_com/status/1832748131894669555


6,081 posted on 09/08/2024 9:27:34 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6080 | View Replies]

To: PIF; All
“Resuming the @tochnyi coverage of the slow-motion disappearance of Russia's last piggy bank, the liquid part of the so-called National Wealth Fund.”




6,082 posted on 09/08/2024 9:30:05 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6081 | View Replies]

To: PIF; All

Peak China.

Hide the data.

“The Chinese authorities are concealing the state of the economy”

“Zhao jian’s article was online for just a few hours on August 16th before censors erased it. To Western readers the content would have appeared anodyne, but to a Communist Party official it was laced with dangerous ideas. Mr Zhao, a respected economist, argued that it was hard to grasp why China’s government was not making more effort to stimulate the economy. The most serious economic downturn in a generation had caused uncertainty about the future to “coil around the hearts of the people”, he wrote. “The logic and constraints of decision-makers cannot be understood by the market.”

The deletion of the article, ironically enough, proved Mr Zhao’s point. China’s army of internet censors routinely purge posts that run counter to the policies of Xi Jinping, the country’s supreme leader. But the realm of what is considered too sensitive has expanded rapidly in recent years, and now includes much discussion about the economy. Academics and pundits who seek to debate seemingly mundane economic matters are silenced. Data that used to be readily available are disappearing from the public sphere. That not only further restricts ordinary people’s already limited freedom to speak their minds, but also harms growth by hampering investment. Most of all, it underscores Mr Zhao’s pressing question: on what basis is economic policy made? What does the government know that ordinary people do not—and how reliable is the information on which it is basing its decisions?

China’s official economic data have always had their flaws. Li Keqiang, the previous prime minister, once questioned their accuracy. Economists have long grumbled that the National Bureau of Statistics (NBS) does not provide enough detail about its methodologies. But China-watchers used to assume that the data would gradually become more comprehensive and reliable. Instead the reverse seems to be happening. Recent data on China’s capital account have been so contradictory—there has been a yawning discrepancy of about $230bn between customs and balance-of-payments statistics in recent years (see chart)—that America’s Treasury called on Chinese officials to clarify the figures. The resulting explanation was so convoluted that it only further confused matters. On August 19th, to the dismay of investors, China’s stock exchanges stopped publishing daily data on flows of foreign capital, a critical gauge of sentiment. The numbers will now be revealed only quarterly”

https://archive.ph/kjjUP


6,083 posted on 09/08/2024 9:32:14 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6082 | View Replies]

To: SpeedyInTexas

China Observer is a good site to learn what is really happening in China day by day. They post many videos showing and interviewing people in China about various affairs, like:

Banking Crisis in China Hits Hong Kong, Foreclosures up for 3 Mos, Surpassing Financial Crash Levels
https://www.youtube.com/watch?v=1-WnmEU0MOc


China’s Shoe Capital Wenzhou Is Ruined! No Orders, Widespread Bankruptcy, Bosses Flee Overnight
https://www.youtube.com/watch?v=Rn0TTN221YQ


China’s Premium Manufacturing Supplanted by India as Apple and Foxconn Exit
https://www.youtube.com/watch?v=-YcbI9mH8uk


Lai Ching-te Pressures Xi to Reclaim 1.5 Million Square Kilometers of Territory Occupied by Russia
https://www.youtube.com/watch?v=KWpmyH5Z7ec


China vs. Japan: Navy Destroyed in 15 Hours, CCP Government Toppled in 7 days?
https://www.youtube.com/watch?v=8Jrt_U1t0a0


6,084 posted on 09/08/2024 10:41:23 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6083 | View Replies]

To: blitz128

“If he did do that they would immediately “Flynn “ him.”

I’ll post 1 day after the election and see if Trump ended the war ‘24 hours after his election day phone call to Indicted War Criminal Little PUkin’

For some reason, I think the war will continue after the election.


6,085 posted on 09/08/2024 11:16:34 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6076 | View Replies]

To: PIF; All

I think RuZZian Boys on FR report back to their commanders in ST. Petersburg that Americans on FR really think there will be a US Civil War again.

Crazies. Crazies. Crazies.

Drunken Boy has waken up.

“Putin Ally Predicts US Will Collapse in ‘Imminent New Civil War’”

“Former Russian Prime Minister Dmitry Medvedev, a close ally of Russian President Vladimir Putin, issued a warning on Saturday predicting the United States will collapse in an “imminent new civil war” amid this year’s election over Russian sanctions.

Since the Russia-Ukraine war began in February 2022, Western countries have imposed sanctions on Moscow, with several thousand sanctions on Russian individuals, businesses, and government institutions. The U.S. has gradually expanded the sanctions it imposed as President Joe Biden issued an executive order in December, which allows the U.S. to directly sanction foreign banks facilitating significant transactions for Russia. Washington threatened to block such banks that conduct business with firms that support Russia’s defense industry from its financial system.

In a Saturday Telegram message, Medvedev, deputy chairman of the Russian Security Council, spoke about the current political climate of the U.S. and the 2024 presidential race, which will see former President Donald Trump, the GOP presidential nominee, face off against Vice President Kamala Harris, who won the Democratic presidential nominee after Biden dropped out of the race on July 21.

“Out of spite for the current administration, Donald Trump has threatened to lift sanctions against Russia. But will he really do it if elected? No, of course not. For all his apparent bravado as an ‘outsider’, Trump is ultimately an establishment insider. Yes, he is an eccentric narcissist, but he is also a pragmatist. As a businessman, Trump understands that sanctions harm the dollar’s dominance in the world. However, that’s insufficient reason to stage a revolution in the United States and go against the anti-Russian line of the notorious Deep State, which is much stronger than any Trump,” Medvedev said.”

https://www.newsweek.com/putin-ally-dmitry-medvedev-predicts-us-collapse-imminent-civil-war-1950276


6,086 posted on 09/08/2024 11:26:42 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6085 | View Replies]

To: PIF

“live” estimate of China’s population.

Counter goes down while you watch it.

Population estimated to fall by 3 million this year after falling by 2 million in 2023.

Population forecast to fall by 150,000,000 between 2025 and 2050.

Staggering.

That is a country in decline.

https://www.worldometers.info/world-population/china-population/


6,087 posted on 09/08/2024 12:17:16 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6084 | View Replies]

To: PIF

Soon China will classify its population as a state secret and no longer release the number.

I’m not joking. I think they will do that.


6,088 posted on 09/08/2024 12:18:21 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6087 | View Replies]

To: PIF

“live” estimate of RuZZia’s population.

It also goes down will watching it.

Forecast to lose 600,000 people this year.

But Ukraine can make it go down faster....

https://www.worldometers.info/world-population/russia-population/


6,089 posted on 09/08/2024 12:28:17 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6088 | View Replies]

To: PIF; All

Just Do It

“The European Union is working on a proposal to censure Slovakia over the erosion of democratic norms in a move that could result in the bloc withholding funds earmarked for Bratislava.

The European Commission, the bloc’s executive arm, has prepared a decision to trigger the procedure over the increasingly populist Prime Minister Robert Fico’s decision to abolish the special prosecutor’s office that oversaw some corruption cases involving EU funds, according to people familiar with the matter.

The process is in an initial phase and would require the approval of Commission President Ursula von der Leyen. A spokesperson for the commission didn’t return requests for comment.

About 80% of all public investments in Slovakia are financed by EU funds. Any potential issues with funding would represent a serious blow to this EU and eurozone member state, which is already facing challenges with excessive deficit in public finances.”

https://www.bloomberg.com/news/articles/2024-09-08/eu-weighs-blocking-slovakia-funds-over-democratic-backsliding?srnd=homepage-americas


6,090 posted on 09/08/2024 12:30:20 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6089 | View Replies]

To: SpeedyInTexas

Dmitry Medvedev is dying of cancer. Everyone in the Russian hierarchy knows it. There was a post about this - what to do: put him out of his misery or let him just wind down.


6,091 posted on 09/08/2024 1:18:32 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6086 | View Replies]

To: SpeedyInTexas

Don’t disagree, but I will take his 24 hours over our “already” secured border


6,092 posted on 09/08/2024 2:01:33 PM PDT by blitz128
[ Post Reply | Private Reply | To 6085 | View Replies]

To: SpeedyInTexas; AdmSmith

From what I have seen and heard locally, the 2025 proposal has stirred up a lot of emotion on both extremes of the political spectrum. Even though Trump has been distancing himself from involvement in this plan, local reports show him as deeply involved in the early phases of this idea.

If the Russians were involved in the early promotion of 2025 here in the US, then it would make sense for Medvedev to say that there is no way President Trump would go along with it given that he is a pragmatic businessman. Who knows how any of this will play out? I can imagine some civil disturbances, but a civil war?? Civil wars are hard on local businesses, Trump probably knows that his businesses, life and golf games would not be comfortable for him.


6,093 posted on 09/08/2024 5:52:42 PM PDT by gleeaikin ( Question authority as you provide links)
[ Post Reply | Private Reply | To 6086 | View Replies]

To: SpeedyInTexas; AdmSmith; PIF; FtrPilot; blitz128; USA-FRANCE; Monterrosa-24; BeauBo; ...

“Putin can’t fight with oil at $40.” Unfortunately, a certain number of US oil people can’t afford to drill or pump at $40 a barrel. A while ago the magic figure for drillers in some of the fracking areas like ND was $80, and when gas prices dropped so low during the Trump administration that on one day there was not even any place to store the oil, a number of oil men stopped drilling or pumping. In fact that is one reason prices have been high. These oil men were not rushing back to work their patches or new leases until they could reasonably expect to make money. They will not drill, drill, drill again until they feel some certainty of making a profit. A few days ago the price was $73 a barrel.

For the past 6 months I have been taking monthly trips in the Maryland and Virginia portions of the DelMarVa Peninsula. I have carefully tracked the price of gasoline each month and on the whole prices for regular at the cheaper stations have run from $3.50 and downward. In my most recent travels the lowest price I saw was $2.95/9. I saw 2 at $2.99/9 and others ran from $3.05 up to $3.29 and various in between. If oil is now at $73, I wonder if gas prices can go much lower without causing the same withdrawal from production as happened last time when prices and profits went too low. I would love to be wrong and will be happy to hear any reasonable arguments explaining why I am.


6,094 posted on 09/08/2024 7:22:25 PM PDT by gleeaikin ( Question authority as you provide links)
[ Post Reply | Private Reply | To 6069 | View Replies]

Russian Offensive Campaign Assessment, September 8, 2024

Central Intelligence Agency Director (CIA) William Burns cautioned the West against concern about boilerplate Russian nuclear saber-rattling, which ISW has long identified as part of a Kremlin effort to promote Western self-deterrence and influence key moments in Western policy debates about support for Ukraine. Burns stated during a panel with United Kingdom Secret Intelligence Service (MI6) Chief Richard Moore on September 7 that Russian President Vladimir Putin will continue to issue periodic threats of direct confrontation against the West but that these threats should not intimidate the West.[1] Burns stated that the CIA had assessed that Russian forces may have considered using tactical nuclear weapons in Ukraine in the fall of 2022 and that he was in contact with Russian Foreign Intelligence Service (SVR) Director Sergei Naryshkin on the matter.[2] The CIA’s assessment of possible Russian readiness to use tactical nuclear weapons in Ukraine in the fall of 2022 corresponded with intensified Russian rhetoric about nuclear confrontation amid the successful Ukrainian counteroffensive operations in Kherson and Kharkiv oblasts.[3] This rhetoric was likely more a part of a routine information operation designed to deter Western security assistance to Ukraine than an indicator of Russian readiness to use nuclear weapons, however.[4] The Kremlin has repeatedly invoked thinly veiled threats of a nuclear confrontation between Russia and the West during key moments in Western political discussions about further military assistance to Ukraine, such as in the fall of 2022, to induce fear among decision makers.[5] ISW continues to assess that Russia is very unlikely to use nuclear weapons in Ukraine or elsewhere.[6]

Russian milbloggers continue to offer insights into how the Kremlin is co-opting select milbloggers to regulate the spread of information in Russia.

The Kremlin has not yet succeeded in co-opting or silencing all Russian milbloggers, however.

The milbloggers’ insights into such incidents suggest that the Kremlin is attempting to co-opt milbloggers or encourage them to self-censor, as opposed to a more aggressive policy of direct censorship.

The Russian Investigative Committee is investigating a “mass brawl” between Russian ultranationalists and Central Asian residents in Afipsky, Krasnodar Krai, amid increased xenophobia against migrants and ethnic minorities in Russia.

Details + map https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-september-8-2024


6,095 posted on 09/08/2024 11:50:11 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6072 | View Replies]

Are the Russians short of tanks?


6,096 posted on 09/09/2024 12:10:00 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6075 | View Replies]










6,097 posted on 09/09/2024 3:24:30 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6073 | View Replies]

To: SpeedyInTexas

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Russians in Big Trouble. Ukrainians Are Retaking The City! ]


Today [ Sept 9 ], there are a lot of updates from the Toresk direction.

Here, the Russians made significant progress in the fight for New York and placed the Ukrainian defenders under siege at a local chemical factory. In response, the Ukrainian command deployed the elite Special Purpose 12th Azov Brigade, which resulted in a dramatic change and liberation of the most fortified part of the city.

Previously, Russian forces seized control of the high-rise district in the western part of the city, an important gain given the nature of the terrain. The remaining areas under Ukrainian control consist mostly of small residential houses surrounding the industrial zone.

With the high-rise buildings providing the Russians with a commanding view and fire control over the low-lying residential areas, Ukrainian positions became increasingly untenable. The lack of fortified defenses in the residential sector forced the Ukrainian forces to consolidate at their only remaining stronghold - the heavily fortified chemical plant.

The Russians were able to advance effectively by leveraging their fire control and observation points from the high-rises, coupled with their numerical superiority and heavy firepower, to push the Ukrainians back toward the chemical plant.

However, their momentum was short-lived, as the Ukrainian forces quickly fortified their positions around the industrial zone, halting the Russian advance just outside the plant. The Ukrainians utilized the plant’s strong defensive structures to withstand the Russian assault, preventing further Russian penetration into the industrial sector.

The New York chemical plant offered formidable defensive advantages that played a crucial role in halting the Russian advance. The plant’s high-rise factory buildings, constructed from concrete and reinforced materials, made them highly resistant to Russian artillery and air strikes. These structures also served as valuable observation points for Ukrainian forces, allowing them to detect Russian movements around the plant and disrupt any planned assaults with precision fire.

Additionally, given the factory’s significant economic importance during the Soviet era, it likely features underground bunkers, providing Ukrainian fighters with essential cover from air strikes and adding another layer of defense in the ongoing battle.

The terrain surrounding the New York chemical plant further strengthens its defensive position. To the west, the Kriviy Torets River and a large pond create natural barriers that would slow down any Russian assault, leaving advancing forces vulnerable to concentrated Ukrainian fire as they attempt to cross.

To the east, beyond the plant, lies a vast open area near railway tracks. Here, any Russian assault units would be exposed to concealed Ukrainian fire from well-defended positions, making an advance across this open terrain extremely dangerous and costly for the attackers. These geographic features significantly bolster the Ukrainians’ defensive strategy, creating choke points and opportunities to inflict heavy losses on Russian forces.

While Ukrainian units in the industrial zone held strong positions, the Russians decided to avoid direct assaults and instead attempted to starve them of ammunition and food. The Ukrainian command recognized this as a pressing issue, as the forces and positions in the chemical plant were instrumental in defending the western flank of Toretsk.

Therefore, elements of the Special Purpose 12th Azov Brigade were deployed to relieve the Ukrainian fighters at the chemical plant and establish a stable supply line to maintain the defense.

The 12th Special Purpose Azov Brigade consists of veteran fighters who played a pivotal role in the Battle of Mariupol and the Donbas war up until 2022, making them some of the most elite and battle-hardened troops in Ukraine’s military.

Following a series of successful prisoner exchanges, these seasoned soldiers were reorganized into the brigade, now commanded by Lieutenant Colonel Denys Prokopenko, the former commander of the original Azov Regiment. His leadership, alongside the combat experience of the brigade, significantly bolsters the Ukrainian defensive efforts in Toretsk.

The Azov fighters were swiftly deployed to the Toretsk direction, with their movements kept highly concealed until the moment of the counterattack. This element of surprise proved crucial. The Russian forces in New York were caught completely off guard as they scrambled to dig trenches and set up barbed wire defenses.

However, their efforts were in vain as they were quickly overwhelmed by the precise coordination between Azov’s drones and artillery which decimated the Russian positions before they could properly fortify.

The Ukrainian fighters systematically deployed artillery and FPV drones to target Russian positions surrounding the chemical plant, aiming to weaken their defenses ahead of the the main assault. The coordinated strikes by as of artillery and drone operators resulted in widespread destruction of Russian firing points hidden within the residential houses around the plant.

This relentless bombardment effectively crippled the Russian forces ability to mount any counterattacks, securing the area for the upcoming Ukrainian offensive. As the intense artillery and drone strikes caught Russians completely off guard, Azov fighters were quickly deployed into assault right after to the powerful bombardments.

The Russian fighters in the city while numerically superior were mostly mobilized personnel who were no match for Azov fighters with over 10 years of combat experience. This led to the defeat of Russian fighters holding the northern residential area of New York and the establishment of a road connection to the chemical plant and its defenders with the main Ukrainian force.

Overall, the deployment of Azov fighters in New York quickly changed the course of the battle as they managed to unblock the regular Ukrainian soldiers under siege. By unblocking the fighters in the chemical plant Ukrainian forces will utilize their defensive capabilities to their full potential.

By maintaining the ground lines of communication with fighters holding the chemical plant, they will receive all necessary logistical support in the form of ammunition and food which enable a long-lasting defense of not just New York, but also the city of Toretsk behind.


6,098 posted on 09/09/2024 4:14:54 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6089 | View Replies]

To: PIF; All

Demilitarization, desatanization and denazification of RuZZia continues.

Russia - 17752, of which: destroyed: 13008, damaged: 785, abandoned: 999, captured: 2960

Tanks (3368, of which destroyed: 2317, damaged: 156, abandoned: 364, captured: 531)


6,099 posted on 09/09/2024 5:35:46 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6098 | View Replies]

To: PIF; All

Oooooooh noooo that’s awful news

“A Russian An-2 aircraft reportedly crashed in the Moscow region near the Vatulino airfield, with both the pilot and co-pilot reportedly killed. The plane was conducting a test flight and was used by a local parachuting club. Emergency services are currently at the crash site.”

https://x.com/NOELreports/status/1833099317931872597


6,100 posted on 09/09/2024 5:41:17 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6099 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 6,061-6,0806,081-6,1006,101-6,120 ... 19,361-19,371 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson