Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 12,321-12,34012,341-12,36012,361-12,380 ... 19,381-19,394 next last
To: FtrPilot

Unstoppable in the Sky How Fiber Optic Drones are Revolutionizing Modern Warfare | 3.25 min
https://www.youtube.com/watch?v=ow9sxZOMtS8

Featuring Magyars Birds


12,341 posted on 02/23/2025 5:27:41 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12338 | View Replies]

To: FtrPilot

Destruction of two D-20 and two D-30 guns. By drones - which explains the sudden increase in the number of tubes destroyed lately.


12,342 posted on 02/23/2025 5:30:49 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12340 | View Replies]

To: PIF

Elon Musk recently saw a drop of over 7 billion dollars after Carlos Slim withdrew from his agreement with Starlink. The catalyst for this fallout was Musk’s controversial tweet suggesting that all Mexicans, including Slim, had connections to drug cartels. In response, Slim wagered a dollar on Musk’s ability to travel to Mars and return, questioning the purpose of colonizing Mars if humanity struggles on Earth.

https://www.threads.net/@chicanopost/post/DGXRmodODL5/elon-musk-recently-saw-a-drop-of-over-7-billion-dollars-after-carlos-slim-withdr


12,343 posted on 02/23/2025 5:37:13 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12342 | View Replies]

To: gleeaikin
g'morning Granny Melon

🍈


Trump’s Pro Russian behavior explained:

Donald Trump Was Recruited by the KGB Under Codename ‘Krasnov’ Claims Former Soviet Spy Chief
https://freerepublic.com/focus/f-chat/4299434/posts

12,295 posted on 02/21/2025 12:22:21 PM PST by PIF (They came for me and mine ... now its your turn)


12,344 posted on 02/23/2025 5:48:24 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12334 | View Replies]

To: PIF
Long range "drones".

🔥😳 160,000 tons of ammunition were destroyed in Toropets, Russia, after which there were 4(!) earthquakes there, — Malyuk

https://x.com/Maks_NAFO_FELLA/status/1893657433907531896

Toropets on Google Maps

12,345 posted on 02/23/2025 5:56:30 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12340 | View Replies]

To: gleeaikin

Yes he got the Kremlin memo, Trump is not our friend😂


12,346 posted on 02/23/2025 5:59:45 AM PST by blitz128
[ Post Reply | Private Reply | To 12334 | View Replies]

To: PIF
Without a doubt, drones are taking out a lot of ruzzian artillery.

ISR drones with thermal cameras can spot artillery tubes after they "scoot."

The fiber optic FPV drones can then punch a hole in the tube.

Now, the limiting factor on the fiber optic FPV drones is battery life.

The only issue that I see is that the fiber optic FPV drone pilot must be stationed near the front.

12,347 posted on 02/23/2025 6:02:06 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12342 | View Replies]

To: PIF

I would add that mortars would be included in the artillery numbers.


12,348 posted on 02/23/2025 6:06:16 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12347 | View Replies]

To: blitz128

Hush Dimwit, your Ukraine war friends all reside on the political Left


12,349 posted on 02/23/2025 6:13:42 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12346 | View Replies]

To: JonPreston


12,350 posted on 02/23/2025 6:14:15 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12349 | View Replies]

To: JonPreston

12,351 posted on 02/23/2025 6:15:04 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12350 | View Replies]

To: blitz128
Ukraine has become the world's #1 producer of drones - Defense Minister Umerov

These drones allow AFU to compensate for the advantage that Russia has over them in artillery. Long-range drones can reach a distance of 1700 km away.

Ukraine domestically procures 96% of the drones used on the battlefield.

https://x.com/Gerashchenko_en/status/1893657907746533483


12,352 posted on 02/23/2025 6:17:39 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12348 | View Replies]

To: PIF
A Russian column of AFVs of 4 tanks, 4 BMPs destroyed by 3rd Assault Brigade.

https://x.com/bayraktar_1love/status/1893657467818582037


12,353 posted on 02/23/2025 6:21:30 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12352 | View Replies]

To: AdmSmith

Slim wagered a dollar on Musk’s ability to travel to Mars and return, questioning the purpose of colonizing Mars if humanity struggles on Earth.


Other than the fact that Homo Sapiens Sapiens has struggled on Earth for 300,000 years, Musk in response radioed, via Starlink, to his crews on his super secret SuperStarShip to direct smallish mile diameter asteroid to Slims location. “Just in case,” Musk said, “better to be sure than have questions later.”


12,354 posted on 02/23/2025 6:22:20 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12343 | View Replies]

To: BeauBo
Estonia is sending a new military aid package to Ukraine, including 10,000 artillery shells and 750,000 food rations for troops. The Prime Minister also stated that additional defense industry products worth over €100 million will be added as soon as possible.

"Ukraine decides its own future. You can always count on Estonia's support," he assured.

https://x.com/NOELreports/status/1893638632361087204


12,355 posted on 02/23/2025 6:24:40 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12352 | View Replies]

To: BeauBo
Ukrainian Air Force F-16AM Fighting Falcon, screaming low over the eastern front on a strike mission.

https://x.com/Osinttechnical/status/1893528209162924117

Most likely, lofting SDBs.

12,356 posted on 02/23/2025 6:29:04 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12355 | View Replies]

To: blitz128
👀✊ "Ukrainian drones costing $700 successfully shoot down Russian reconnaissance UAVs, which cost over $100,000," — Malyuk

"Where the enemy has "great know-how" at work, we simply find the key to solving these issues."

https://x.com/UkrReview/status/1893669462936535471

IMHO, this is not about "cost of drones."

This is about the target intel that both sides get from their ISR drones.

ISR drones fly at an altitude where visual acquisition is difficult to impossible.

UKF has demonstrated the ability to locate ruzzian ISR drones and vector an FPV drone to intercept and destroy the ruzzian drone.

12,357 posted on 02/23/2025 6:37:58 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12356 | View Replies]

To: PIF; BroJoeK; speedy; BeauBo; dimwit

Zelenskys depleted army now control less than 400km² of Russias Kursk region, thats down from 1,200km²

Russian troops have inflicted massive losses on Ukraine in men and materiel, more than 75,000 killed, over 170,000 injured, thousands of vehicles destroyed.

All For nothing pic.twitter.com/ASW4nhDZ66— Chay Bowes (@BowesChay) February 23, 2025


12,358 posted on 02/23/2025 6:43:19 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12354 | View Replies]

To: PIF
🇵🇱 After meeting with Trump, Polish President Duda emphasized that Ukraine cannot survive without U.S. aid and stressed the importance of strengthening economic ties between the two countries.

He stated that Russia must not be allowed to win, reminding everyone that Putin is a former KGB officer. Duda also highlighted the need for lasting peace and security guarantees, confirming that the U.S. military presence in Poland will remain, and possibly even increase.

https://x.com/NOELreports/status/1893592456245002329


12,359 posted on 02/23/2025 6:46:42 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12357 | View Replies]

To: AdmSmith
❗️ Ukraine is developing new long-range weapons, already striking 1,700 km into Russia, – Commander in Chief Syrskyi said.

"Despite Moscow's failed attempts to seize Ukraine, tough battles lie ahead, and our task is to keep hitting the enemy," he added.

https://x.com/NOELreports/status/1893670361662677006


12,360 posted on 02/23/2025 6:56:45 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12359 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 12,321-12,34012,341-12,36012,361-12,380 ... 19,381-19,394 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson