Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Update from Ukraine | Ruzzia Lost the important General on The South | Ukraine Takes more ground
Youtube.com ^ | 6-12-2023 | Denys Davydov

Posted on 06/12/2023 6:10:25 PM PDT by UMCRevMom@aol.com

Update from Ukraine | Ruzzia Lost the important General on The South | Ukraine Takes more ground

https://www.youtube.com/watch?v=eLenKE01l2A

The summary of the situation of Russian re-invasion to Ukraine covering the last 48 hours, as of 12th June 2023 – 22:00 (Kyiv time)

https://militaryland.net/news/invasion-day-474-summary/

*** Great interactive map with viewer controlled Map magnification tool to use for each Front!

https://militaryland.net/maps/


TOPICS:
KEYWORDS: agitproppingforbucks; fakenews; itsrussianotruzzia; liarslying; pedosupporter; reportfordutydenys; ukepropoganda
Navigation: use the links below to view more comments.
first previous 1-2021-4041-54 next last
To: Widget Jr

“This is going to go step by step and slow, taking weeks or months. It will not go fast like Kharkiv or Kherson.”

Yup. This will take a while.


21 posted on 06/12/2023 6:54:28 PM PDT by ought-six (Multiculturalism is national suicide, and political correctness is the cyanide capsule. )
[ Post Reply | Private Reply | To 15 | View Replies]

To: Alter Kaker

“The Russian habit of losing flag officers reflects the repeated breakdown of their chain of command, the failure of their army to delegate decision making to front line commanders and their complete lack of a non-commissioned officer corps.”

That is very true, and has been the Russian way of war for generations.


22 posted on 06/12/2023 6:56:43 PM PDT by ought-six (Multiculturalism is national suicide, and political correctness is the cyanide capsule. )
[ Post Reply | Private Reply | To 20 | View Replies]

To: All

VIDEOS

1. Major Ukrainian Breakthroughs in the south! | Ruzzian Defences are Crumbling! | Ukraine Update
Artur Rehi
626K subscribers
Jun 12, 2023 10:00 a.m. EDT
https://www.youtube.com/watch?v=0sqYWR2aRlM

2. Ukrainian offensive gaining ground | Eastern Express | TVP World
TVP World
353K subscribers
6-12-2023 6:00 p.m. EDT
https://www.youtube.com/watch?v=Kq9dHA8kUkM


23 posted on 06/12/2023 6:57:25 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasionbeen pals with )
[ Post Reply | Private Reply | To 19 | View Replies]

To: Dogbert41

There are 44 four-star officers in the US military. But I agree with your point - they are often far behind the lines. Unlike in the Russian military, however, the U.S. and its Western Allie’s trust their subordinate officers to run the battles. In Russia, the senior officers have to lead from the front. Given their valuable experience and training, such a practice is not bravery, but stupidity.


24 posted on 06/12/2023 7:17:13 PM PDT by Apparatchik (If you find yourself in a confusing situation, simply laugh knowingly and walk away - Jim Ignatowski)
[ Post Reply | Private Reply | To 10 | View Replies]

To: UMCRevMom@aol.com

very good news:

“7 settlements were liberated: Lobkove, Levadne, Novodarivka, Neskuchne, Storozheve, Makarivka, Blahodatne.”

May it get better and better...until Ukraine is free and sovereign again with self-determination


25 posted on 06/12/2023 8:35:28 PM PDT by Sunsong
[ Post Reply | Private Reply | To 3 | View Replies]

To: UMCRevMom@aol.com
Related, OSINT: "Ukraine: UA offensive is gaining ground - only a matter of time before the Russian defences collapse". TVP World - Rock Rochon.

On Monday's episode of "Rock Rachon" we talk about the Ukrainian Army offensive that is evicting the Russians from the lands they have appropriated. According to our guest, Thomas C. Theiner, a former artilleryman of the Italian army, the Russians have almost 70% of their soldiers engaged in active combat, while the Ukrainians use only 10% of their forces in their maneuver warfare offensive. Without another mobilization, the Russians will not be able to stop the Ukrainians. We talk to Joe Lindsley about „Ukrainian corruption”, the myths of which, fuelled by Russian online trolls, do a lot of damage to organizations that support the defence of Ukraine. According to the American journalist living in Ukraine since 2020, a deeper look at the case shows that most of this corruption has its roots not in Ukraine... but in Russia.
That Ukrainian column that was destroyed by mines and artillery, the one where the pictures are posted several times a day? That was 70% of the Ukrainian losses so far. The Russian army and called up reserves are getting hammered hard. This is information the Russian Web Brigades are going to actively ignore.
26 posted on 06/12/2023 8:39:42 PM PDT by Widget Jr (🇺🇦 Слава Україні! 🇺🇦 Sláva Ukrayíni! 🇺🇦 ☭ No CCCP 2.0 ☭)
[ Post Reply | Private Reply | To 23 | View Replies]

To: AdmSmith; AmericanInTokyo; amnestynone; Apparatchik; AZJeep; babble-on; TheBattman; BeauBo; bert; ..

VIDEO WITH SUMMARIZED COMMENTARY:

12 Jun: Clever. Ukrainians Take 2 Towns WITHOUT FIRING A SINGLE SHOT! | War in Ukraine Explained
Reporting from Ukraine
https://www.youtube.com/watch?v=5X0_uEEPgvA

⚠️ Watch RFU in 18+ languages: https://www.youtube.com/@RFU/channels

I am Ukrainian. My country has been invaded by Russia. In this video I will tell you what happened on the four hundred and seventy fourth day of the war.

Day 474: Jun 12

Today Ukrainian 35th Marine Brigade posted a video of clearing the houses and raising the Ukrainian flag above Storozheve. This is the village that Russians previously tried to preserve control of and even launched mechanized counterattacks.

The Marines also showed one of such counterattacks, and judging by the footage, Russians used several squads of infantry reinforced with 1 tank and 3 armored fighting vehicles. Since Ukrainians were in control of the tactical heights, the counterattack was quickly rebuffed, and the whole assault unit was eliminated.

Today Ukrainian Deputy Defense Minister also confirmed yesterday’s claims and speculations and verified that Ukrainians successfully pushed Russians from Levadne and gained an important foothold on the next ridge of tactical heights. If we look at the topographic map, we can see that from Levadne, Ukrainians can conveniently continue slicing off Russian defenses.

If you still remember, yesterday I told you that the fall of Levadne means that the Russian defense in Novodarivka and Rivnopil will automatically collapse due to the threat of encirclement. And this is exactly what happened today.
After seeing that the escape window was closing at an unprecedented rate, Russian forces wasted no time and retreated from Novodarivka.

Ukrainian forces have already entered Russian fortifications in and around the settlement, and as Russian Intelligence reported, Ukrainians are demining the field between this settlement and Novopil and overall preparing the roads for easy and stable supplies for further development of the counteroffensive operation.

Some Russian sources reported that Russian forces launched a powerful counterattack in the direction of Makarivka and are about to return everything that they lost, however, it looks like this is just a supporting attack that tries to protect the flanks of the retreating forces from Rivnopil because some Russian sources already started mentioning that the village is in the grey zone.

Yesterday, I told you that the fact that Russians blew up the dam highly likely means that they abandoned Urozhaine because otherwise, they would doom their own forces by cutting them off with the flooding. Today some sources started to confirm that Ukrainians established full control over this settlement, and started developing their attack further.

In order to complicate Ukrainian advances even more, today, Russian forces blew up the second dam on this river, which means that Ukrainians will not be able to assault Russian settlements from the east. This saves the Russian defense from the immediate and uncontrollable collapse because right now, Russian forces at least manage to organize a coherent retreat.

When it comes to the eastern part of the region, the fights around Novodonetske continue. Today Ukrainian 4th Tank Brigade released a video of how they are destroying Russian fortification in the tree lines west of the settlement and widening the bridgehead. It is expected that very soon, Ukrainians will also launch an attack on Kermenchyk, as they are already on the approach to this settlement.

In the meantime, Ukrainian Air Force continues conducting precision strikes on Russian military bases and command posts. One of the biggest strikes happened in Henychesk, which was previously considered one of the safest parts of the Kherson region, which is why it gradually became the occupational administrative center.

Ukrainian sources reported that they stuck one of the biggest Russian headquarters in the south. Ukrainians also continue conducting HIMARS strikes on Melitopol, Tokmak, and Molochne.

Russian sources confirmed that in the aftermath of one of these strikes, Ukrainians have destroyed the headquarter of the highest level of command and eliminated the commander of the 35th Russian Army, Major General Goryachev. It was reported that this time almost all Russian generals were deployed to the Zaporizhzhia direction to be in touch with what is happening on the front and prevent another catastrophe, even the Chief of the Russian General Staff, Gerasimov, is reportedly somewhere in Zaporizhhzia, so Ukrainians Intelligence and Air Force are currently on a big hunt.

*** Select the 3 horizontal dots to view the Complete Transcript [Below video/ top right corner]


27 posted on 06/12/2023 9:07:45 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasionbeen pals with )
[ Post Reply | Private Reply | To 26 | View Replies]

To: UMCRevMom@aol.com

Ukes should always advance under the cover of drones; some to take out rus drones, some to take out rus soldiers and equipment, some to coordinate uke artillery fire.


28 posted on 06/12/2023 9:12:06 PM PDT by ckilmer (ui)
[ Post Reply | Private Reply | To 12 | View Replies]

To: All

VIDEOS

1. 13 June: Russians panic in Crimea! Ukrainians HIT THE RUSSIAN MAIN SUPPLY BASES | Ukraine Updates
Divine Justice
146K subscribers
Jun 12, 2023 9:00 p.m. EDT
https://www.youtube.com/watch?v=jBEDHVG1Y88

2. Putin Era in the Kremlin is Coming to an End! Russian Oligarchs Have Pulled the Plug on Putin
NIT International
320K subscribers
Jun 12, 2023 11:00 p.m. EDT
https://www.youtube.com/watch?v=oP139DcDCRI


29 posted on 06/12/2023 9:32:31 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasionbeen pals with )
[ Post Reply | Private Reply | To 27 | View Replies]

To: All

ARTICLE

Russians drowned hundreds of Ukrainians in the occupied Kherson oblast left bank
June 12, 2023 3:01 pm
Ukraine Frontlines
https://ukrainefrontlines.com/opinion/analytics/hundreds-of-ukrainians-drowned-by-the-russians-in-the-occupied-left-bank-of-kherson-region/

It is difficult to write this post because at this moment the water is taking the lives and homes of my acquaintances, friends, and relatives in the city of Oleshky, occupied Kherson Oblast left bank.

Perhaps the least we can do remotely is to talk about ALL the people on the left bank, spread information to the international media and draw attention to the scale of the disaster created by the Russians after the blow-up of the Kakhovka HPP.

At June 7, 2023, the city of Oleshky resembled an island on which survivors gather, and all nearby villages are completely flooded.

In the areas that were the first to be flooded on June 6, there were floating corpses (plural!) of people who could not evacuate. Most likely, these are old women with limited mobility, stroke patients, and disabled people injured as a result of the flood. That is, all those who were on the roofs yesterday and were washed away by the current at night or flooded directly in their houses.

City chats with pleas (!) for help do not subside for the many days.

At the same time, artillery duels continue in the city and its surroundings. Therefore, people on the roofs and top floors of buildings also have a hard time. Can you imagine the atmosphere?!

Locals gather in groups, occupy the last dry areas in the central districts of the city and help themselves with the evacuation of those who have been floating in the flooded one-story buildings for a long time.

In nearby villages (Solontsi, Sahy, Pidstepne), the situation is even worse- the current and higher water level make evacuation on rubber boats impossible. I see in the chat rooms that they are BEGGING for help for grandfather Vasyl and his wife from 13 Kvitkova Str., (46.613161, 32.745101). They have run out of drinking water, they are being washed off the roof. He is ready to swim close to (!) the boat so that he can cling to it.

I lost direct contact with Oleshky at June 6 between 7 and 9 in the morning. I was VERY surprised that almost no one there knew about the blow-up of the HPP. Most began to realize something when the first water came in the morning.

But could any of the locals imagine the scale and consequences on the second day, being in an information vacuum?!

It is scary to imagine what will happen tomorrow, because not everyone has managed to stock up on drinking water and food.

What about the russians?

According to messages in local chats, last night they blocked the exit from the city and fired at the tow boats.

Isn’t this genocide?!

Yesterday morning I was informed about more than 90 corpses in Oleshky alone.

Today, the water level dropped and volunteers began to see a large number of dead people in flooded houses.

We are talking about HUNDREDS OF PEOPLE DROWNED BY THE RUSSIANS in Oleshky alone.

Can you imagine the total number of dead in Hola Prystan, Kokany, Kardashynka, Velyka Kardashynka, Mala Kardashynka, Pidstepne, Poima, Nechayev, Vynrozsadnyk, Pishchanivka, Livi Sahy, Livi Solontsi, Pravi Sahy, Pravi Solontsi, Rybalche, Nova Zburiivka, Stara Zburiika, Zabaryne, Vynohradne, Kozach Laheri, Krynky, Korsunka?

Knowing all this, it is difficult for me to listen to our news and respected experts when they emphasize that this is an “ecological disaster”, “crisis”, etc.

There is nothing AT ALL in the Russian information field.

People! The Russians are keeping quiet about the mass murder committed by them!

We informed earlier that hundreds of Ukrainians have gone missing on the occupied flooded left bank after the Kakhovka Dam blow up.

Updates: The russian invaders closed the city of Oleshki in the Kherson region, which was flooded due to the explosion of the Kakhovskaya HPP. There is no communication, electricity and gas supply in the community, evacuation is not actually carried out.


30 posted on 06/12/2023 9:55:49 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasionbeen pals with )
[ Post Reply | Private Reply | To 29 | View Replies]

To: UMCRevMom@aol.com
COMMENT #30 PHOTOS
31 posted on 06/12/2023 9:59:03 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasionbeen pals with )
[ Post Reply | Private Reply | To 30 | View Replies]

To: UMCRevMom@aol.com

ARTICLE
Kakhovka Dam destruction: first official deaths and reports on missing civilians
Ukraine Frontlines
June 12, 2023 12:20 pm
https://ukrainefrontlines.com/news/ukraine/kakhovka-dam-destruction-first-official-deaths-and-reports-on-missing-civilians/

NOTE: *indicates my emphasis

The latest official updates on Kakhovka Dam destruction says that at least 10 people died as a result of the explosion made by the russian occupiers at the Kakhovka Hydro Power Plant.

In the Kherson region, 46 settlements remain flooded. 8 people died. 42 persons are considered missing, including 7 children. In the Mykolaiv region, 31 settlements were flooded. 2 people died.

3,704 people have already been evacuated from Kherson region and Mykolaiv region. This was stated by the head of the Ministry of Internal Affairs of Ukraine.

2,722 people were rescued from the territory of Kherson region, including 205 children, 76 citizens with limited mobility. It is also known about 5 dead.

982 people were evacuated from the Mykolaiv region, including 167 children. Two people died.

Meantime, the head of the Kherson Regional Military Administration Oleksandr Prokudin reports that 112 people have already been evacuated from the occupied coast of the Kherson Region.

The russian occupiers PREVENT EVACUATION BY SHOOTING PEOPLE IN THE BACK.* The water level in the flooded settlements of the Kherson region is currently 3.29 m on average.

As before, 46 villages and towns of the region remain flooded. 32 of them are on the Right Bank, 14 on the Left Bank.

Water in flooded settlements is gradually receding. However, the weather conditions have worsened: it is raining almost all over the Kherson region, but this will not stop the rescue work, reported the Minister of Internal Affairs Ihor Klymenko.

The following data is also known:

-In the Kherson region, as of 1:00 p.m. on Sunday, June 11, 5 people were killed, 35 are considered missing, including 7 children, in the area of flooding caused by Russians undermining the Kakhovskaya HPP. In Kherson Oblast, 46 settlements were actually flooded, of which 32 (3,821 houses) were in the territory controlled by Ukraine, and 14 were in the territory temporarily captured by the Russians. 2,718 people were evacuated, including 190 children.

-In the Mykolaiv region, 31 settlements were flooded. 982 people were evacuated, including 167 children. 1 person died.

-In the Dnipropetrovsk region, there is no water supply for almost 162 thousand subscribers in 34 settlements. Drinking and technical water is being delivered.


32 posted on 06/12/2023 10:06:53 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasionbeen pals with )
[ Post Reply | Private Reply | To 31 | View Replies]

To: Alter Kaker

The Russian habit of losing flag officers reflects the repeated breakdown of their chain of command, the failure of their army to delegate decision making to front line commanders and their complete lack of a non-commissioned officer corps.

Delegation requires trust. Russia is a low-trust society where everyone is in full CYA mode because people who piss off Putin or the oligarchs have a habit of disappearing.

33 posted on 06/12/2023 10:35:46 PM PDT by FormerFRLurker
[ Post Reply | Private Reply | To 20 | View Replies]

To: All

VIDEOS

1. Prigozhin refused to comply Shoigu’s order
Kanal13
1.58M subscribers
6-12-2023 10:00 p.m. EDT

Interesting???

2. Shoigun’s millionaire son left Russia and took refuge in Turkey
Kanal13
1.58M subscribers
6-12-2023
https://www.youtube.com/watch?v=Gc7zuDaiyQ8


34 posted on 06/12/2023 10:43:25 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasionbeen pals with )
[ Post Reply | Private Reply | To 32 | View Replies]

To: All

ADDENDUM LINK for Comment #34

1. Prigozhin refused to comply Shoigu’s order
Kanal13
1.58M subscribers
6-12-2023 10:00 p.m. EDT
https://www.youtube.com/watch?v=LyB52uHYPFg&t=8s


35 posted on 06/12/2023 10:45:52 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasionbeen pals with )
[ Post Reply | Private Reply | To 34 | View Replies]

To: UMCRevMom@aol.com

The [Ukraine] SSU liquidated a bot farm in Vinnytsia [200 Km southwest from Kyiv], which created up to 500 fake accounts every day to "disperse" kremlin narratives.

Specialized equipment allowed criminals to register up to 500 anonymous accounts in various social networks every day, including those banned in Ukraine.

According to the case file, the Russian clients of the bot farm used fake accounts for mass "dispersal" of pro-Kremlin narratives. In particular, regarding the situation at the front and the socio-political situation in Ukraine. [FLASH News, June 12, 2023]


36 posted on 06/12/2023 11:23:28 PM PDT by linMcHlp
[ Post Reply | Private Reply | To 18 | View Replies]

To: UMCRevMom@aol.com

Russia will give up land as they create massive minefields for a DMZ to protect the Russia citizens of the Donbas region.They have laid thousands of antipersonnel mines via missile deployment which have created an impenetrable barrier against Ukrainian armor and foot soldiers. It will take years to remove these mines.


37 posted on 06/12/2023 11:35:21 PM PDT by pterional (scorched earth)
[ Post Reply | Private Reply | To 1 | View Replies]

To: UMCRevMom@aol.com
Residents of Russian-occupied Enerhodar recorded videos of the receding Dnipro river. It exposed that Russians have been mining the whole area with PDM-1m mines which are designed to repel amphibious attacks. [Tendar, June 12, 2023]

Russian Special-landmine:


38 posted on 06/12/2023 11:41:00 PM PDT by linMcHlp
[ Post Reply | Private Reply | To 35 | View Replies]

To: UMCRevMom@aol.com

The terrible reality of war The hedgehog carries on its back an anti-personnel land mine also known as a Butterfly Mine.

https://twitter.com/nexta_tv/status/1667898349305974791


39 posted on 06/13/2023 12:39:14 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 35 | View Replies]

To: tennmountainman

What is your own information flow based on?

What is the evidence you have to refute these reports?


40 posted on 06/13/2023 1:59:33 AM PDT by AmericanInTokyo (Pray for Jim. ***** Donate to FR (Freepathon) )
[ Post Reply | Private Reply | To 6 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-54 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson