Just for fun I ran the same human sequence against the Rhesus monkey.
>gb|AANU01283423.1| Macaca mulatta 1099214608000, whole genome shotgun sequence Length=19382 Score = 446 bits (241), Expect = 4e-123 Identities = 266/278 (95%), Gaps = 1/278 (0%) Strand=Plus/Minus Query 1 CCAGCGTGCGTGTTCCTGTGCCTGTGGGAGCTGGCTATCTCAGCGGGTGGGTGCCTCACC 60 |||||||||||||| |||||||||||||||||||| |||||| |||||||||||||||| Sbjct 12573 CCAGCGTGCGTGTT-CTGTGCCTGTGGGAGCTGGCCGTCTCAGTGGGTGGGTGCCTCACC 12515 Query 61 TTGCCCTGTCCTCCCCCTCGACCTCACTCTCCTTCCTTCTCATCCCCCTCCAGATTGACA 120 |||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| Sbjct 12514 CTGCCCTGTCCTCCCCCTCGACCTCACTCTCCTTCCTTCTCATTCTCCTCCAGATTGACA 12455 Query 121 AGTATCTCTATGCCATGCGGCTCTCCGATGAAACTCTCATAGATATCATGACTCGCTTCA 180 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct 12454 AGTATCTCTATGCCATGCGGCTGTCCGATGAAACTCTCATAGATATCATGACTCGCTTCA 12395 Query 181 GGAAGGAGATGAAGAATGGCCTCTCCCGGGATTTTAATCCAACAGCCACAGTCAAGATGT 240 |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 12394 AGAAGGAAATGAAGAATGGCCTCTCCCGGGATTTTAATCCAACAGCCACAGTCAAGATGT 12335 Query 241 TGCCAACATTCGTAAGGTCCATTCCTGATGGCTCTGGT 278 |||||||||||||||| |||||||| |||||||||||| Sbjct 12334 TGCCAACATTCGTAAGATCCATTCCCGATGGCTCTGGT 12297
Whereas the chimp sequence was 99% the same as a human, the monkey is 95% same as a human.
Furthermore, the two base pairs in the chimp genome that were different from human (TA->GC along the first row, query is human, subject is monkey) are the same in the monkey and chimp. Chimp and monkey have GC, human has TA. However, they monkey has further changes that aren't in common with either chimp or human. So, the human and chimp share many of the same genes, and they are both slightly different than the monkey. There's a progression. Chimp is just a little different than human, monkey is a little more far removed from human. Etc. Just what one would expect from common ancestry.
The was already a great deal geological and fossil evidence in support of evolutionary theory. Comparative genomics has only strengthened the theory.