Dinosaur Shocker (YEC say dinosaur soft tissue couldn’t possibly survive millions of years)

Smithsonian Magazine ^ | May 1, 2006 | Helen Fields

[William Terrell]

I think they use the reasoning that if God can creat anything, He can start with things as they were 5,000 or 6,000 years ago.

Maybe if there is a young earther on this thread, he can correct me.

[BrandtMichaels]

Thanks for the scripture reference. I often struggle to remember exact references.

Also, I found it interesting in college I had a discussion with a physics major. He stated that although physics formulas could explain nearly everything regarding time and space one dilemma still remained. The causation for energy flow from one form to another (i.e. the growth and decay of an apple).

In considering God's invisible qualities - He being all-seeing, all-knowing, and all-powerful. Power being energy, I contemplated some years later that if you take these qualities universally then you begin to see how nothing exists w/o Him. God is the one who is always actively at work maintaining the balance of the universe. Miracles are nothing for God but transmogrifying the sub-atomic structure of the atoms (i.e. making water gush forth from solid rock).

Comforting then to know that He is with all of us always just in the very act of sustaining our lives.

Interesting too that my chiropractor pointed out how all our lives every cell and organ of our bodies are constantly being regenerated. That within a years time every cell in your body has been replaced - some faster than others. God makes all thing new.

[Right Wing Professor]

One creationist response to such arguments regarding human/chimp DNA similarity has been that ‘Chimp DNA has not been anywhere near fully sequenced so that a proper comparison can be made’,5 and that this evidence is just as easily explained (and predicted, for that matter) by the concept of a common designer:

You might try finding a reference from a legitimate source, not Answers in Genesis, an on-line catalog of lies and half-truths. You might also choose an up-to-date reference. The two genomes are now published and on line.

[js1138]

You shouldn't be surprised. You are speaking to troll who hangs on to creationist arguments that Ken Ham has abandoned as too embarrassing such as the dino/human footprints.

[Right Wing Professor]

My, what an eloquent reply.

Finding pictures was probably easier for you than pulling up the genomes, huh?

[Right Wing Professor]

Hey Elsie, here's a different kind of text dump. Two stretches of genomes, both from Chromosome 10, one human, one chimp. Which is you and which is the ape?

CCAGCGTGCGTGTTCCTGTGCCTGTGGGAG
CTGGCTATCTCAGCGGGTGGGTGCCTCACC
TTGCCCTGTCCTCCCCCTCGACCTCACTCT
CCTTCCTTCTCATCCCCCTCCAGATTGACA
AGTATCTCTATGCCATGCGGCTCTCCGATG
AAACTCTCATAGATATCATGACTCGCTTCA
GGAAGGAGATGAAGAATGGCCTCTCCCGG
GATTTTAATCCAACAGCCACAGTCAAGATG
TTGCCAACATTCGTAAGGTCCATTCCTGAT
GGCTCTGGT

CCAGCGTGCGTGTTCCTGTGCCTGTGGGAG
CTGGCTATCTTGGCGGGTGGGTGCCTCACC
TTGCCCTGTCCTCCCCCTCGACCTCACTCT
CCTTCCTTCTCATCCCCCTCCAGATTGACA
AGTATCTCTATGCCATGCGGCTCTCCGATG
AAACTCTCATAGATATCATGACTCGCTTCA
GGAAGGAGATGAAGAATGGCCTCTCCCGG
GATTTTAATCCAACAGCCACAGTCAAGATG
TTGCCAACATTCGTAAGGTCCATTCCTGAT
GGCTCTGGT

Go ahead. It's really easy.

[mlc9852]

Answers in Genesis is a legitimate source. Just because you disagree with it doesn't make it not legitimate.

[Right Wing Professor]

Answers in Genesis is a legitimate source.

In your dreams.

[2nsdammit]

I say this in every one of these threads:

"Micro-evolution" IS evolution. Why is it so difficult to understand that when you spread out small, incremental steps over a very long period of time, large changes can occur?

By the way, how do you know that other animals don't have some form of abstract thinking, spiritual awareness, etc? Just because they don't manifest them in complex language doesn't mean they don't have some rudimentary "minds". Surely you don't believe that animals don't communicate with each other, and with us. Watch your pets interact with each other; they most certainly are communicating.

[ahayes]

See #63.

[mlc9852]

I doubt you know anything about my dreams, oh high Professor.

[Doctor Stochastic]

Yes.

[Right Wing Professor]

I doubt you know anything about my dreams, oh high Professor.

Vee program your dreams und beam zem into your head zrough ze tooth fillings. Be afraid. Be very afraid.

[Kozak]

Please explain to me where Darwin and the Theory of Evolution contradict a Creator.

[BrandtMichaels]

Dear all FR readers actually,

I have not always been a YEC but my faith has 'evolved' (OK actually strengthened) as I have (and still continue) to read God's Word. My cousin is a pastor. At a family reunion we we're discussing an idea I had run across on the internet that since a day is as a thousand years and a thousand years as a day that possibly creation was a 6,000 year 'week'.

This was a very weak argument as soon as I unfolded it. He simply pointed out how we need to take the Bible literally when it is speaking literally. How with each creation day God defined it with 'there was evening and there was morning' while the 1000 day reference was symbolic of Christ's return.

He also pointed out that altering God's Word to say something it doesn't is tantamount to what we see liberal christian churches doing today (i.e. homosexuality). That possibly we can come to question and lose our very salvation when we begin to re-define God's Holy Word.

I saw this website refernced on FR a while back - the best and most complete explanation for YEC that I have seen yet: http://www.creationscience.com/ I've read the book twice now - once online and then again when I bought the book.

It shows why age-dating is so very confusing. As a computer programmer/analyst for over 20 years I know what havoc assumptions can do to application code (esp. unstated/unknown assumptions).

Furthermore, if the physical universe had not undergone some very very extreme changes, then evolution seems more palatable when viewed in the reference of uniformtarianism - the idea that certain conditions have always been the same since the beginning of time. Yet we know w/ global-warming this is not true. Heck, if it were just true w/ app code I would either a.) only need to write new code or b.) be out of a job.

Actually, I spend close to 80% of the time maintaining old code - usaually that which didn't follow the KISS principle b/c some bozo was so proud of how complicated (err sophisticated) he could write it. I should thank all the bozos for my job security but the jury is still out due to mgmt decisions to outsource and/or replace w/ H1B's.

Consider this too. 1st Earth was perfect - prior to original sin. 2nd Earth was better than today's b/c mankind lived close to 1,000 years - possibly due simply to plant/animal foods being much more highly nutritious. 3rd Earth is todays - and God said he would limit mans' time to 120 years. Recent scientific research concluded the same.

Some would say 4th Earth was AD till now but I think it is actaully the new Heaven/Earth from Revelations that follows Armageddon.

BTW last night I prayed for all you fine folks on here - yes the evolutionists too - not just bc I once were one.

I was analyzing over God's Word about praying constantly and wondering why an all-powerful God requires this. I realized first that prayer brings me closer to God. But I also think I had a revelation - consider that this world is utterly polluted by sin. That sin constanly dirties the windows of our atmosphere. Then think of prayer as a window cleaner that could basically clear it away and allow God's Light to shine on your life and all those lives that you pray over. Obviously no matter how much Biblical truth is revealed to you - you won't understand it here in your fallen sinful physical nature but you can always get closer than before and help others in the process.

I have always enjoyed learning and will continue to do so - till? - well after my physical demise I think. Here another website you may find insightful: www.oneplace.com/ministries/Grace_to_You/ - per my John MacArthur references. Sorry so long and Godspeed to all.

[2nsdammit]

"Believe it or not, neither does AIG, but that doesn't stop people from posting it on FR."

I think that's the most frustrating part of these threads - we continue to show how the ID "evidence" is wrong, has been disproven, or even is an outright hoax, and the same stuff keeps cropping up, whack-a-mole-like.....

[Right Wing Professor]

It shows why age-dating is so very confusing.

We set problems on age dating in Freshman Chemistry class. Most of them (and they're mostly not chemistry majors) don't seem to be confused.

As a computer programmer/analyst for over 20 years I know what havoc assumptions can do to application code (esp. unstated/unknown assumptions).

Identify one unstated/unknown assumption in radioisotope dating.

[Right Wing Professor]

Yes.

Is that your final answer? :-)

[BrandtMichaels]

Sorry for the spelling and grammatical errors. Thought I didn't have more time here at the public library.

Meant to say:
Obviously no matter how much Biblical truth is revealed to you - you won't understand it ALL here in your fallen sinful physical nature but you can always get closer than before and help others in the process.

[BrandtMichaels]

There are plenty of them on the creationscience site I listed which I much prefer over AIG (read that one too).

Maybe we'd all be better off if we listed our own assumptions. I think nothing would keep each person busier than spending time trying to eliminate their own assumptions and/or hypocrisy - I know bc I am a work in progress on both of these still so please forgive my errors as I do yours.