Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Truck in Nice Attack: Important to test for fingerprints/DNA on weapons
15-July-2016 | Vanity

Posted on 07/15/2016 12:19:40 AM PDT by topher

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-39 last
To: topher

Truck also had bullet proof windshield; police did not search truck prior to delivering “ice cream”; nor did the police have weapons capable of stopping the truck or penetrating the windscreen.

Other attackers are muslims located in France’s vast muslim enclaves - no terror will be stopped until all muslims are removed from French soil ...


21 posted on 07/15/2016 3:53:32 AM PDT by PIF (They came for me and mine ... now it is your turn ...)
[ Post Reply | Private Reply | To 1 | View Replies]

To: PIF

“Truck also had bullet proof windshield”

Really? Why? Wasn’t this a rented truck?


22 posted on 07/15/2016 4:03:47 AM PDT by pieceofthepuzzle
[ Post Reply | Private Reply | To 21 | View Replies]

To: pepsionice

“It would be hard enough in the US to force everyone to volunteer for DNA testing.”

‘Force’ everyone to ‘volunteer’.


23 posted on 07/15/2016 4:06:42 AM PDT by dljordan (WhoVoltaire: "To find out who rules over you, simply find out who you are not allowed to criticize.")
[ Post Reply | Private Reply | To 3 | View Replies]

To: Flick Lives

I usually don’t watch these types of programs but there were two good series on TV recently, The Night Manager and Last of the Panthers. They were both about the illegal gun trade in Europe. While I am well aware the programs were fiction I have to believe there is a whole underbelly of society that many people did not know exists. This latest terrorist attack in France makes you realize that these “fictional “ programs had actually hit too close to home.


24 posted on 07/15/2016 4:17:01 AM PDT by heylady
[ Post Reply | Private Reply | To 20 | View Replies]

To: topher; SunkenCiv
Europe should consider fingerprinting/getting DNA on all immigrants and even current citizens.

Already done:

The EURODAC database contains fingerprints of asylum seekers in the EU, persons who illegally crossed the borders of the EU or have been caught illegally on the territory of a Member State. By comparing fingerprints, a Member State may determine if an asylum seeker, a person caught crossing the EU border illegally or a person caught illegally on the territory of an EU Member State, applied for asylum in another Member State.
http://www.eppgroup.eu/press-release/EURODAC-fingerprints-database

The EU is planning wholesale changes to the bloc’s asylum law. In addition to a “fairer” distribution system for refugees and an extension of border controls within the Schengen area, the Eurodac fingerprint database, which is currently used to identify asylum seekers and irregular migrants, is to be enlarged.

The system is set to be supplemented with facial recognition software and personal data will be stored for a longer period of time, with the aim of ensuring that irregular migrants stay on the authorities’ radar; the information of underage refugees will also be kept.

http://www.euractiv.com/section/justice-home-affairs/news/eu-proposes-minority-report-style-facial-recognition-for-refugees/

25 posted on 07/15/2016 4:22:23 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: topher

They won’t do it, they might offend the Muslim’s.


26 posted on 07/15/2016 4:50:12 AM PDT by fortheDeclaration (Pr 14:34 Righteousness exalteth a nation:but sin is a reproach to any people)
[ Post Reply | Private Reply | To 1 | View Replies]

To: topher

Something for French patriots to think about:

If jihadists can find and buy rifles and grenades, so can French patriots.


27 posted on 07/15/2016 4:54:53 AM PDT by sergeantdave
[ Post Reply | Private Reply | To 1 | View Replies]

To: pieceofthepuzzle

Look at the windscreen - the bullets did not shatter nor penetrate - rent truck take to secret shop, replace windscreen - not too difficult an operation taking an hour at most.


28 posted on 07/15/2016 5:13:07 AM PDT by PIF (They came for me and mine ... now it is your turn ...)
[ Post Reply | Private Reply | To 22 | View Replies]

To: topher

Check the credit card for renting the truck. Name on it is probably George Soris.


29 posted on 07/15/2016 6:33:24 AM PDT by ThePatriotsFlag ( Anything FREELY-GIVEN by the government was TAKEN from someone else.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: dinodino

Thank you for info.


30 posted on 07/15/2016 8:24:47 AM PDT by ColdOne (poochie... Tasha 2000~3/14/11~GOPe=Vichy Republican swine)
[ Post Reply | Private Reply | To 15 | View Replies]

To: PIF

“Look at the windscreen - the bullets did not shatter nor penetrate - rent truck take to secret shop, replace windscreen - not too difficult an operation taking an hour at most.”

Understood, but there can’t be that many places that make bulletproof glass for a truck like that, I would think. Should be traceable?


31 posted on 07/15/2016 8:45:46 AM PDT by pieceofthepuzzle
[ Post Reply | Private Reply | To 28 | View Replies]

To: ColdOne

I think the sub-set Long Guns could include non-rifled weapons such as shot guns and some smooth bore black powder weapons.


32 posted on 07/15/2016 8:49:14 AM PDT by KC Burke (Consider all of my posts as first drafts. (Apologies to L. Niven))
[ Post Reply | Private Reply | To 12 | View Replies]

To: KC Burke

Ok that makes sense. I just notice the media using that term...long guns more and more.


33 posted on 07/15/2016 8:54:01 AM PDT by ColdOne (poochie... Tasha 2000~3/14/11~GOPe=Vichy Republican swine)
[ Post Reply | Private Reply | To 32 | View Replies]

To: ColdOne

It is sure more reasonable than calling everything an “assault rifle” like some have done.


34 posted on 07/15/2016 8:58:57 AM PDT by KC Burke (Consider all of my posts as first drafts. (Apologies to L. Niven))
[ Post Reply | Private Reply | To 33 | View Replies]

To: PIF

The photos I’ve seen were of standard laminated safety glass, which definitely had bullet holes in it. Windshields don’t shatter like window glass.


35 posted on 07/15/2016 8:59:02 AM PDT by Charles Martel (Endeavor to persevere...)
[ Post Reply | Private Reply | To 28 | View Replies]

To: topher

I wonder if any of these are Fast ‘n’ Furious oopsies that were smuggled across the pond from Mexico?


36 posted on 07/15/2016 9:06:43 AM PDT by Sirius Lee (If Trump loses, America dies)
[ Post Reply | Private Reply | To 1 | View Replies]

To: KC Burke

;)


37 posted on 07/15/2016 9:08:31 AM PDT by ColdOne (poochie... Tasha 2000~3/14/11~GOPe=Vichy Republican swine)
[ Post Reply | Private Reply | To 34 | View Replies]

To: topher

Limiting it to recent arrivals wouldn’t be at all effective in Europe. Lots of second and third generation immigrants from North Africa in France.


38 posted on 07/15/2016 9:14:37 AM PDT by semimojo
[ Post Reply | Private Reply | To 1 | View Replies]

To: dinodino

I was talking about what was in the truck; not what the terrorist had with him.


39 posted on 07/15/2016 1:54:28 PM PDT by nopardons
[ Post Reply | Private Reply | To 11 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-39 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson