Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

To: AdmSmith

5,710 posted on 08/25/2024 1:24:25 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5684 | View Replies ]


To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view. ]

The complete transcript.

[ Kornevo Front Collapses: Ukrainians Push Deep Behind Russian Lines ]


Today [ Aug 25 ], there are a lot of updates from the Kursk direction.

Here, in a decisive maneuver, Ukrainian forces initiated a series of flank attacks around Korenevo, forcing Russian troops to scatter and weaken their defenses. Seizing the moment, they launched a sudden, powerful assault on Korenevo, catching the Russians off guard and breaking through into the town.

Following recent territorial gains near Korenevo, Ukrainian forces have been stalled on both the northern and southern flanks of the town. To the northeast, around the recently captured villages of Olgovka and Matveevka, Ukrainian troops faced obstacles due to the natural barrier posed by the Krepna River and its reservoirs.

This terrain advantage enabled Russian forces to strengthen their defensive positions, making it more difficult for Ukrainian forces to advance further north.

The village of Zhuravli, captured during earlier Ukrainian offensives, lies north of the Krepna River. This location offers a strategic advantage for the Ukrainians, as it allows them to maintain a bridgehead across the river, facilitating potential assaults that could bypass the main Russian defenses positioned near Olgovka.

However, the limited infrastructure of Zhuravli restricts the Ukrainian ability to support a large-scale assault force capable of overwhelming Russian defenses along the river. At the same time, Russian forces in the area lack sufficient troops to mount a counterattack against the Ukrainian bridgehead at Zhuravli.

Given the challenging circumstances, the Ukrainian objective in this area is to outflank the Russian defenses along the Krepna River and break through their positions in the villages of Durovka, Zhebolovka, and Vetreno.

The area between these villages consists of wide open fields with no significant Russian defenses, leaving the town as the last organized line of resistance. By securing these villages, Ukrainian forces could execute a flanking maneuver to the north, advancing toward the town and bringing the battle directly to Korenevo.

To achieve this, Ukrainian forces must expand their bridgehead north of the Krepna River, which requires intensifying their offensive efforts toward the town of Kauchuk. The Ukrainians are targeting the villages south of Kauchuk to stretch Russian defenses along the Krepna River and link up with the bridgehead at Zhuravli. By doing so, Ukrainian command could reinforce the bridgehead with additional troops, paving the way for a final push north toward Korenevo.

Unlike Korenevo and its flanks, the area around Kauchuk is less heavily defended by Russian forces due to a shortage of combat-ready troops in Kursk, with most of their focus concentrated on Korenevo. In the Kauchuk region, the Russians are relying on a limited number of naval infantry units, which are spread thin across the area to engage in skirmishes with Ukrainian sabotage and reconnaissance groups.

Beyond these scattered marines, the Russians lack an organized line of defense in this sector, making it vulnerable to Ukrainian attacks and potential deep strikes into their rear.

Combat footage from the region, shows a group of Ukrainian fighters dismounting from a Stryker vehicle after successfully engaging Russian forces deep behind enemy lines. One of the fighters later shared footage of a neutralized Russian soldier inside an intact UAZ truck equipped with electronic warfare systems.

These systems are typically deployed in rear areas to protect frontline troops from drone strikes, confirming that Ukrainian forces managed to penetrate deep into Russian-held territory.

By exploiting these Russian vulnerabilities and deploying assault units strategically, Ukrainian forces successfully captured the village of Semyonovka. Controlling Semyonovka has effectively encircled the settlement of Sheptukhovka, putting it in a precarious position.

The fall of Sheptukhovka would enable Ukrainian forces to link up with the fighters at the Zhuravli bridgehead, reinforcing their position and supporting further offensive operations.

On the southern flank of Korenevo, Russian defenses were as weak as on the Northern flank ,due to the concentration of most troops within the town itself.

Exploiting these vulnerabilities Ukrainian forces captured the villages of ?Aanova? and ?Tritksa? while consolidating control over ?Krasnoovobosye? Securing ?Aanova?and ?Tritksa? allowed the Ukrainian to fortify their southern flank and advance from ?Krasnoovobosye? into the forest south of Korenevo.

Due to the growing threat on the town’s flanks the Russian command decided to redeploy troops from Korenevo to reinforce these vulnerable positions and hold the Ukrainian advance.

Believing that the main Ukrainian assault front against Korenevo had lost its combat effectiveness after days of stalemate, the Russian command assessed it was safe to shift forces away from the town.

Unfortunately for the Russian Ukrainian fighters in front of Korenevo took the circumstances to their advantage and launched a powerful assault directly into the town. Geolocated footage shows that the Ukrainians entered the eastern part of the town initiating the battle for Korenevo.

Overall, the Ukrainians took notice of Russian weak spots on the flanks of Korenevo and carefully exploited them to shatter Russian defenses.

As a result the Russian command weakened the town’s defenses to bolster the flanks which allowed Ukrainian forces to launch an assault and enter Korenevo. The shortage of Russian reserves in the area proved decisive for the Ukrainian tactical gains, consequently Russian sources are now claiming that under these circumstances the loss of Korenevo is inevitable.


5,714 posted on 08/25/2024 4:10:30 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5710 | View Replies ]

To: AdmSmith

5,743 posted on 08/26/2024 4:07:54 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5710 | View Replies ]

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson