Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

To: BeauBo

A $90 million (almost 1 billion rubles) bridge between Russia and the DPRK will be built by a loss-making company with four employees. The contractor for the contract ТоннельЮжСтрой. In 2023, it recorded a net loss of more than $500 thousand. The company has not completed major projects and does not even have its own website. The company must build the bridge by the end of 2026.

https://t.me/bankrollo/37937

At least they have a bank account.


11,360 posted on 02/05/2025 12:37:07 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11357 | View Replies ]


To: AdmSmith

90 million, does it cross a creek?
After primary skims half, then hired contractor who skims half….


11,361 posted on 02/05/2025 4:22:25 AM PST by blitz128
[ Post Reply | Private Reply | To 11360 | View Replies ]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ ]

Today [ Feb 03, 8 pm ], there are a lot of interesting updates from the Kursk direction.

Here, the North Korean forces, with poor coordination, a crippling language barrier, and complete unpreparedness for modern warfare, their relentless attacks are at risk of collapse, signaling a major setback for Russian plans on this front.

Thrown into battle as expendable assault troops, they now face such devastating losses that they have been completely withdrawn from Kursk, with Ukrainian special forces sent in to finish the job.

Russian commanders had planned to utilize the North Korean soldiers to achieve a breakthrough in the Ukrainian Kursk salient. With Russians running low on manpower, using North Korean soldiers would save their strength for a final push to claim victory for themselves.

To achieve this, the North Korean forces were being deployed as the vanguard of each assault, initiating the fight first and forming the primary waves of each assault meant to wear down the Ukrainian defenses.

Reports by Ukrainian soldiers on the ground indicate that, in isolation, North Korean soldiers are quite skilled with weapons, after undergoing ten years of military service. Interestingly, new footage of Ukrainian fighters also revealed that North Korean soldiers were armed even better than the Russian soldiers, using new Russian AK-12 assault rifles, thermal image sights, and laser range finders.

However, despite the extensive training and discipline of individual North Korean soldiers, the isolation of North Korea from the outside world, prevented their military from adjusting to the reality of modern warfare, leaving them extremely vulnerable as a unit as a whole.

On top of that, even though North Koreans could have been used in small infantry group tactics, the Russian high command has inadequately used them as human waves to frontally assault Ukrainian positions over open fields.

Additionally, North Koreans suffered from a lack of cohesion with Russian units, due to the language barrier combined with different tactics from Russians, preventing them from receiving adequate fire support from Russian artillery and armored vehicles.

With North Korean casualties skyrocketing, due to these disadvantages, the intensity of their assaults had already significantly decreased, meaning that Ukrainians had to find a clever way to finish the job. Ukrainians did this by deploying special forces units to target positions held by the more poorly trained Russian soldiers to create a gap in the enemy lines.

With Russians unable to call North Korean reinforcements for assistance due to the language barrier, these preliminary positions could be quickly cleared out by the Ukrainian special forces.

This then allowed the Ukrainians to gain an element of surprise to eliminate the numerically superior North Korean forces by assaulting them from behind, unaware that their flanks, which were held by weaker Russian units, were breached.

With severe losses mounting even outside of the assaults, the North Korean forces had to halt all offensive and defensive operations in Kursk, pulling back completely to reorganize themselves and set up a new plan.

To resolve the issue of a lack of artillery and armored support to aid their assaults, North Korea is deploying its own artillery units in the form of Koksan self-propelled guns and potentially additional heavy equipment such as tanks and armored vehicles as well.

Intelligence reports indicate that such a deployment will be complemented by an additional force of another 11,000 North Korean soldiers by April, allowing North Koreans to reconstitute their contingent after suffering nearly 40% of their soldiers as irrecoverable casualties.

Overall, the elimination of large amounts of North Korean forces came as a result of poor unit cohesion and a language barrier between Russians and North Koreans, further worsened by a lack of adaptation to modern warfare by North Korean fighters. With North Koreans pulling out of the Russian Kursk operation, the recent transfers of their own heavy equipment and further reinforcements, indicate that North Koreans plan to restart their offensive efforts in Kursk in the future, but this time with adequate support.

However, due to the severity of North Korean losses, this reorganization period will take several months at the least to conduct properly, with any sooner re-engagement of forces likely leading to a similar catastrophe as before.


11,367 posted on 02/05/2025 5:47:42 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11360 | View Replies ]

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson