Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 8,561-8,5808,581-8,6008,601-8,620 ... 20,201-20,202 next last
To: marcusmaximus; BeauBo
BDA:

Usually well informed channel Dosye Sphiona reported about the recent Storm Shadow strikes in the Kursk region.

On November 20, 2024, at around 15:00, a missile strike targeted a command post in the village of Mar'ino, Rylsky district, Kursk region, using British-French "Storm Shadow/SCALP" missiles. The attack resulted in 18 military casualties and 33 wounded, including three North Korean soldiers. The injured were taken to the Rylsk Central Hospital, with most victims being officers from the Southern and Eastern Military Districts.

At the time of the strike, Lieutenant General Solodchuk, the deputy commander of the Leningrad Military District, was present at the command post, though his condition remains unknown. Additionally, at around 19:00, an explosion from an unknown ordnance at the site injured 13 soldiers from the 88th sapper regiment, including the deputy chief of staff.

https://x.com/NOELreports/status/1859598576503906776


8,581 posted on 11/21/2024 6:30:24 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8580 | View Replies]

To: PIF
BREAKING

Explosions in Sevastopol. Neptune is working.

https://x.com/Heroiam_Slava/status/1859593734221873340


8,582 posted on 11/21/2024 7:02:36 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8581 | View Replies]

To: PIF
🔥Two 🇷🇺 Russian invaders decided to hide under the tree, however, they were found and punished by a 🇺🇦 Ukrainian FPV drone of the 414th Regiment «Birds of Magyar»

https://x.com/GloOouD/status/1859613452366483774


8,583 posted on 11/21/2024 7:06:15 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8582 | View Replies]

To: FtrPilot

Good drone porn!


8,584 posted on 11/21/2024 7:08:38 AM PST by mad_as_he$$
[ Post Reply | Private Reply | To 8583 | View Replies]

To: FtrPilot

Graphic text translated - note the use of ‘killed’ instead of ‘casualties’

The Spy’s Dossier * Regarding the defeat of the KP in the Kursk region. Yesterday, 11/20/2024 at about 15:00, a missile attack was launched on a command post located in the settlement of Maryino, Rylsky district, Kursk region. The strike was carried out with the use of a British-French-made “Storm Shadow/SCALP”. As a result of the strike, 18 servicemen were killed, and 33 more were injured of varying severity.

Among the wounded are 3 North Korean servicemen (2 men with severe wounds and 1 female medic with a lung). The wounded were taken to the Rila CRH. Most of the victims are officers of the Southern Military District and the Air Force.

It is also reported that at the time of the strike, the first deputy commander of the LenVO troops, Lieutenant General Solodchuk, was at the checkpoint. There is no information about his condition yet. Further, an incident is reported that occurred during the dismantling of rubble at the scene. At about 19:00, as a result of the detonation of an unknown munition, 13 servicemen from the 88th Sapper regiment unit (military unit 53359) were injured. Among the injured is the deputy chief of staff of the regiment. @dosye_shpiona t.me/dosye_shpiona/618


8,585 posted on 11/21/2024 7:12:27 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8581 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Point-Blank Tank Raid. Russian Soldiers Eradicated ]


Today [ Nov 21 ], there is a lot of news from the Pokrovsk direction.

Here, in a stark demonstration of the consequences of poorly coordinated offensives, Russian forces suffered devastating losses during their recent wave of attacks, leaving their surviving units scattered across a vast territory and vulnerable. Seizing the opportunity, Ukrainian forces launched a swift counterattack, effortlessly reclaiming lost ground and exposing the fragility of the Russian foothold.

In recent days, the Russians initiated an offensive across multiple fronts, with their primary objective in the southwest focused on advancing along the railway line from Selydove toward settlements south of Pokrovsk.

Their goal was to place key Ukrainian supply lines in the city under fire control, thereby disrupting logistics and exerting pressure on defensive positions. To achieve this, they utilized Selydove as their operational base. However, their progress quickly stalled as the terrain ahead presented significant challenges.

If we look at the topographic map, we can see that the terrain in the Selydove area consists of a mix of relatively low-lying areas, with higher ridges dispersed. While Selydove itself appears on slightly higher ground relative to some of the surrounding villages like Hryhorivka, the terrain towards Novooleksiivka gradually levels off, providing limited opportunities for sustained observation points.

Despite the elevation in some areas, the terrain lacks significant natural cover like forests or hills because of the vast areas of open agricultural fields, making attacking Russian forces not only highly visible to Ukrainian defenders but also vulnerable to minefields, which the Ukrainians have thoroughly prepared and enriched in the past weeks.

At the same time, Novooleksiivka benefits from slightly higher terrain elevations compared to the approaches from Selydove. This height advantage, although not steep, offers better fields of observation for defensive forces combined with the usage of the natural barriers to establish protected supply routes, ensuring logistical continuity under pressure.

Additionally, Novooleksiivka is surrounded by a dispersed network of roads, providing defenders with the flexibility to quickly reinforce their positions or execute tactical withdrawals. This advantage enabled the Ukrainians to mount an effective counterattack against the remnants of Russian forces that had briefly established a foothold in the village.

Drone operators from the Omega Special Forces unit of the National Guard of Ukraine released a compelling video showcasing their coordinated efforts to eliminate the remaining Russian troops entrenched in Novooleksiivka. The operation began with 2 Ukrainian tanks boldly advancing into the village, using precision strikes to target several houses identified through aerial surveillance as key positions, harboring concentrated Russian forces.

After completing their assault, the 1st tank withdrew, deploying a smoke screen to obscure its movements and shield itself from any counterattacks. However, as it retreated, a Russian FPV drone emerged over the horizon, targeting the 2nd tank that had remained in position to cover the withdrawal.

At this critical moment, the Ukrainian tank crew demonstrated their expert knowledge of the terrain, choosing a position in a lowland area that created a radio shadow, disrupting the drone’s ability to strike its target. Also, the vulnerable parts of the tank were shielded by nearby bushes, further complicating the drone’s attempts to attack.

The footage continues with several attempts of the Russian drone to attack but without success. It hovered, waiting for the moment to strike, but the tank confused the operators’ plans with a deceptive maneuver, managed to fire another shot, and released a new smoke screen.

Visible from the footage, the drone started looking for a target where there was no longer one. This allowed both Ukrainian tanks to take cover with electronic warfare and return to safety. The Russian kamikaze drone, having lost connection to the operators, simply rose into the sky and later crashed.

Overall, the Ukrainian forces effectively leveraged the terrain around Selydove to counter the Russian advance, turning the enemy offensive into an opportunity for a decisive counterattack, and proving that the Russian tactic of generating advances by throwing meat waves works poorly. Even though Russians managed to infiltrate multiple settlements with the survivors of their suicidal assaults. they had weak control over them and that allowed the Ukrainians to regain positions with ease.


8,586 posted on 11/21/2024 7:31:05 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8580 | View Replies]

To: FtrPilot

Rumors General Aleksandr Lapin was killed in the decapitation strike.


8,587 posted on 11/21/2024 7:34:33 AM PST by marcusmaximus
[ Post Reply | Private Reply | To 8581 | View Replies]

To: marcusmaximus

8,588 posted on 11/21/2024 8:28:37 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8587 | View Replies]

To: PIF

Hope they got him.


8,589 posted on 11/21/2024 8:32:48 AM PST by marcusmaximus
[ Post Reply | Private Reply | To 8588 | View Replies]

To: marcusmaximus
Me too.
8,590 posted on 11/21/2024 9:17:15 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8589 | View Replies]

To: BeauBo
More vodka please.

⚡️🇷🇺 Russian Z-STS "Akhmat" armored vehicle had an accident in the Belgorod region

https://x.com/front_ukrainian/status/1859286147282747424


8,591 posted on 11/21/2024 9:28:12 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8590 | View Replies]

To: PIF

Pehaps he would have survived had he only been awarded a few more medals.


8,592 posted on 11/21/2024 9:56:19 AM PST by Mr. Lucky
[ Post Reply | Private Reply | To 8588 | View Replies]

To: Mr. Lucky

Right! Now those North Korean general are well covered in medals. They might survive a nuke with all those medals, and Kim would give them at least one more for that feat.


8,593 posted on 11/21/2024 10:09:39 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8592 | View Replies]

To: ETCM; AdmSmith

“Yi Peng 3 is both the primary suspect in the cable cuttings and is now detained”

ChiCom ship - but a Russian Captain, sailing from a Russian port.


8,594 posted on 11/21/2024 10:39:22 AM PST by BeauBo
[ Post Reply | Private Reply | To 8517 | View Replies]

To: BroJoeK

“a loss of electric power in Cuba will not be as life-threatening to Cubans as it will be to civilians this winter in Ukraine or Russia.”

True.

But the implications are still pretty severe. Gas pumps and water pumps out of operation, widespread loss of refrigeration for food and medical products, widespread interruption of business activity and communications. The whole electrical infrastructure is 15 years beyond its 25 year expected useful life.

Politically, it is a significant threshold in the regime’s ability to continue to operate. What white knight will come to the rescue with an additional 70,000 barrels per day of oil? (on top of 20.000 that Mexico is providing)

Potentially, this could trigger a significant wave of emigration, or disruptive political events.


8,595 posted on 11/21/2024 10:56:19 AM PST by BeauBo
[ Post Reply | Private Reply | To 8578 | View Replies]

To: BeauBo

What white knight will come to the rescue with an additional 70,000 barrels per day of oil?


biden?


8,596 posted on 11/21/2024 11:00:34 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8595 | View Replies]

To: PIF

Unlike Obama, Biden kept Trump’s sanctions on Cuba in place.


8,597 posted on 11/21/2024 11:23:42 AM PST by BeauBo
[ Post Reply | Private Reply | To 8596 | View Replies]

To: PIF

Another day, another tightening of the the financial noose around the neck of Russia’s Government and economy.

Kyiv Independent reports:

“US imposes sanctions on over 50 Russian banks, including Gazprombank

“The U.S. Treasury Department imposed sanctions on dozens of Russian banks, including Gazprombank, securities registrars, and financial officials, according to a Nov. 21 statement...

...”Today’s sanctions targeting Russia’s largest remaining non-designated bank, as well as dozens of other financial institutions and officials in Russia, will further diminish and degrade Russia’s war machine,” U.S. Treasury Secretary Janet Yellen said.

The U.S. had refrained from targeting Gazprombank to allow European countries to continue paying for Russian gas supplies, as the bank is the primary channel for energy-related payments, Financial Times reported.

“This sweeping action will make it harder for the Kremlin to evade U.S. sanctions and fund and equip its military.”

The outlet also noted that Russia used Gazprombank to purchase military equipment, pay soldiers, and compensate the families of those killed in the war in Ukraine.

The new U.S. sanctions will close one of Russia’s few remaining avenues for international banking, barring Gazprombank from conducting transactions in dollars”


8,598 posted on 11/21/2024 11:51:32 AM PST by BeauBo
[ Post Reply | Private Reply | To 8586 | View Replies]

To: BeauBo

Alexander Stechentsev is the maritime pilot, the captain is Zhou Bin.


8,599 posted on 11/21/2024 11:52:10 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8594 | View Replies]

To: SpeedyInTexas

You okay? Haven’t heard from you lately
Keith


8,600 posted on 11/21/2024 12:09:24 PM PST by blitz128
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 8,561-8,5808,581-8,6008,601-8,620 ... 20,201-20,202 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson