Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 7,901-7,9207,921-7,9407,941-7,960 ... 20,201-20,212 next last
To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Scorched & Dislodged. Russians Suffer Major Setback ]


Today [ Nov 04 ], there are a lot of interesting updates from the Toretsk direction.

Here, the Ukrainians successfully destroyed once-powerful Russian defensive positions by extensively using improvised explosives by demolition squads. This significantly destabilized Russian positions in this part of the front, giving the Ukrainians an opportunity for the second wave of counterattacks.

Earlier, Russian operations in Toretsk’s central high-rise area stalled as their forces faced constant raids by Ukrainian stormtrooper squads, coordinated with drone strikes. Over time, Ukrainian drone attacks intensified, with combat footage showing Russian soldiers attempting to play dead in a desperate effort to evade drones, only to be detected and eliminated.

Unlike in many other areas of the front, Ukrainian drone operators in Toretsk were able to more easily locate Russian drone positions. Combat footage from one operation showed a Ukrainian drone identifying Russian drone operators 3 kilometers behind the frontline and destroying their base.

Such strikes significantly suppressed Russian drone activity in Toretsk, enabling Ukrainian soldiers to assault Russian positions with reduced risk of drone strikes.

With Russian drone activity suppressed, Ukrainian soldiers seized the opportunity to approach Russian defensive positions in central high-rises and demolish them with heavy explosives. A video shared by Ukrainian fighters reveals their preparation of explosives for demolition squads, mostly improvising with available resources.

They repurposed 17 TM-62 anti-tank mines and C-4 charges, bundling them into large packages and attaching cables for detonation. These explosive devices are powerful enough to destroy large high-rise buildings where many Russian fighters are stationed.

Combat footage from the high-rise area shows the detonation of these explosives, completely destroying a nine-story building used by Russian forces to amass troops, operate drones, and establish command points. Another video captures the demolition of a second high-rise with similar improvised explosives.

These high-rises offered strategic firing positions for Russian soldiers, who used them to set up machine guns, anti-tank missile posts, and drone launch sites. With the destruction of these buildings, Russian defenses in the high-rise area were significantly weakened, as most of the structures were reduced to ruins.

The destruction of key Russian firing positions and drone bases set the stage for a coordinated Ukrainian counterattack on Toretsk’s central high-rises. The Ukrainians initially targeted two high-rises facing the northern part of the city, creating a gap in Russian defenses that allowed Ukrainian stormtroopers to advance behind the remaining high-rises.

Buildings facing westward were ineffective in repelling Ukrainian assaults, as their narrow, windowless sides left them with blind spots. With their main defensive positions compromised, Russian forces were pushed from the compromised high-rises.

The Ukrainian counterattack successfully recaptured a 3rd of the high-rise district and surrounding areas in central Toretsk, with ongoing efforts to push Russian forces out of the remaining high-rise positions.

Overall, the Ukrainians successfully suppressed the Russian firing positions, demolished them with explosives, and gradually started retaking lost positions from crumbling Russian defenses.

Ukrainian Luhansk Group of Forces Spokesperson Major Anastasiya Bobovnikova reported that Russian forces have decreased their attacks in Toretsk, but have not decreased their artillery and air strikes.

Intense artillery and air strikes have however switched their purpose, as Russians are desperately trying to suppress advancing Ukrainians in all-out defense, which often led to accidentally bombing their troops in brutal friendly-fire incidents, which help to amplify Ukrainian operations even more.


7,921 posted on 11/04/2024 4:50:04 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7918 | View Replies]

To: BeauBo

The Russian have lost some ground in Toretsk. See report above.


7,922 posted on 11/04/2024 4:52:23 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7916 | View Replies]

Russian Offensive Campaign Assessment, November 3, 2024

Ukrainian Navy Spokesperson Captain Third Rank Dmytro Pletenchuk reported on November 2 that the Russian naval infantry units cannot be considered “elite” due to lack of specialized training for new recruits and because Ukrainian forces have destroyed the main core of the Russian professional army since the start of the Russian full-scale invasion.[70] Pletenchuk highlighted that the composition of Russian naval infantry forces does not significantly differ from other units, implying that formerly elite naval infantry forces are now operating like other infantry or mechanized infantry units due to lack of specialized training, as ISW has long assessed.

Incumbent Moldova President Maia Sandu has claimed victory in the Moldovan presidential runoff election held on November 3, 2024.[1] Preliminary results reported by the Moldovan Central Election Commission (CEC) show that Maia Sandu has won around 55 percent of the vote, defeating Kremlin-friendly presidential candidate Alexandr Stoianoglo.[2] The Moldovan CEC reported on November 3 that over 54 percent of the Moldovan electorate voted in the presidential runoff elections compared to the approximately 51 percent voter turnout during the first election round held on October 20, 2024. The reported voter turnout for the runoff election is also over the minimum legal turnout requirement of 20 percent.[3] ISW will cover the final result of the runoff Moldovan presidential elections on November 4 after the Moldovan CEC finishes counting all votes, including votes from the Moldovan diaspora voters whose votes take longer to count due to time zone differences.

Moldovan authorities reported extensive Russian interference and sabotage efforts during the runoff presidential elections held on November 3, 2024, in a likely effort to favor pro-Kremlin Stoianoglo. Sandu’s National Security Advisor Stanislav Secrieru warned on November 3 of significant Russian interference in the runoff election, noting the organization of voter transport in Transnistria (which is illegal under Moldovan law); the organization of buses and charter flights from Russia to polling stations in Azerbaijan, Turkey, and Belarus; the distribution of vouchers to Moldovan voters in Moscow; and cyberattacks against the Moldova CEC’s voter education site.[4] Moldovan Independent Press Agency IPN reported on November 2 that Russian authorities preemptively transported 150 Moldovan citizens from Russia to Moldova via Turkey for free in a concerted effort to maximize the voter base of Kremlin-friendly Stoianoglo.[5] Moldovan authorities also notified numerous Western countries about Russian efforts to disrupt Moldovan diaspora voting abroad by creating false bomb threats at polling stations.[6] The Moldovan diaspora notably largely favored Sandu in the first round of the presidential elections. Moldovan Prime Minister Dorin Recean stated that Moldovans throughout the country had received anonymous “death threats” through phone calls, likely as part of a scare tactic to sway election results.[7] ISW previously reported on large-scale Russian intervention efforts in the first round of the 2024 Moldovan presidential elections in order to enhance the outcome in favor of Stoianoglo and against Moldova's European Union (EU) referendum vote, which ultimately passed by a small margin.[8] Sandu stated on October 21 that “criminal groups” and “foreign forces” — likely referring to Russia and Kremlin-linked Moldovan opposition politician Ilan Shor — used tens of millions of euros to spread propaganda to destabilize Moldova.[9] Sandu also stated that Moldovan authorities had evidence that the criminal groups wanted to buy 300,000 Moldovan votes during the first round of presidential elections and that the scale of fraud was “unprecedented.”[10]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-november-3-2024

7,923 posted on 11/04/2024 4:53:35 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7875 | View Replies]

Russia will launch two Iranian satellites, Kowsar and Hodhod, into orbit on Nov. 5 using a Soyuz launcher, Iranian Ambassador to Russia Kazem Jalali said on Nov. 4.

“In continuation of the development of scientific and technological cooperation between Iran and Russia, two Iranian satellites, Kowsar and Hodhow, will be launched into 500-kilometer orbit on Tuesday, Nov. (5), at 2:48 Tehran time by a Soyuz launcher, Jalali said on X.

The delivery of the two satellites to Russia was reported on Oct. 12, underscoring the deepening cooperation of the two Western-sanctioned countries.
Russia previously launched Iranian satellites into orbit in February and again in 2022, raising concerns from U.S. officials about the potential military implications. These officials worry that the satellites could support Russia's operations in Ukraine and help Iran monitor military targets across Israel and the Middle East. The ties between Moscow and Tehran deepened since the outbreak of the full-scale war in 2022. Iran has provided Russia with thousands of Shahed drones used in attacks against Ukraine and even close-range ballistic missiles.

https://kyivindependent.com/russia-to-launch-2-iranian-satellites-on-nov-5-irans-ambassador-says/

7,924 posted on 11/04/2024 5:09:19 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7879 | View Replies]

To: PIF
Russian BMP masterfully disembarks infantry right under Ukrainian drones.

https://x.com/bayraktar_1love/status/1853098899512193098


7,925 posted on 11/04/2024 5:39:05 AM PST by FtrPilot
[ Post Reply | Private Reply | To 7922 | View Replies]

To: SpeedyInTexas; PIF
I just discovered this pic online. It appears to be a Ukrainian Air Force F-16 with a full AMRAAM load, including the wingtips. This suggests a fully updated F-16 or Block 50 or newer.

Can any Air Force type enlighten me?

https://x.com/blackcloudsix/status/1853152678274121918

All the aircrafts Ukraine recieved are block 15/20 MLU, block 50 standard without the upgraded radar, armaments being 2xCATM-120B on wingtips, 2xAIM9L/M on station 2 & 8, same loadout as this picture.

https://x.com/amraam1975/status/1853172332405350862


7,926 posted on 11/04/2024 6:46:35 AM PST by FtrPilot
[ Post Reply | Private Reply | To 7925 | View Replies]

More than 700 000 troops !
note: It was an error in the data for 3NOV2024, it should have been 699,090
7,927 posted on 11/04/2024 6:51:28 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7879 | View Replies]

To: AdmSmith

Sending congratulatory gifts to Putin on his masterful job of getting so many troops killed. Awaiting 800,000.


7,928 posted on 11/04/2024 7:28:24 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7927 | View Replies]

To: BeauBo
✈️🔥 A Ukrainian MiG-29 from the 114th Tactical Aviation Brigade strikes with 8 GBU-39 Small Diameter Bombs on Russian infantry concentrations and ammo depots in the Orikhiv direction.

Russians are planning to go on the offensive here.

https://x.com/NOELreports/status/1853456831873507722

Apparently, SDBs are working fine.

I am disappointed that GLSDBs are not in use.


7,929 posted on 11/04/2024 7:32:11 AM PST by FtrPilot
[ Post Reply | Private Reply | To 7926 | View Replies]

To: PIF
Overnight, Russia launched 80 Shahed drones of which 77 were shot down. 50 by regular air defense and 27 by electronic warfare.

https://x.com/NOELreports/status/1853334526522437856


7,930 posted on 11/04/2024 7:34:58 AM PST by FtrPilot
[ Post Reply | Private Reply | To 7929 | View Replies]

To: PIF; BeauBo; SpeedyInTexas; AdmSmith
BURN RATE: As Russian passes 700,000 casualties in Ukraine, here are a few thoughts on why their losses are so high.

Four factors come to mind:

1) In 20 years, Putin has permitted a culture of corruption to fester within the armed forces. Senior and General officers gain their positions (and the money that comes from graft) by participating in a pyramid scheme of corruption. Advancement is by participation in kickbacks and theft: not military competence or merit. Putin has raised two generations of officers who are venial and unprofessional. They are unfit to lead.

2) Russia has lost so many experienced troops, training has suffered. Approximately 400,000 Russian troops invaded. 700,000 have become casualties. Virtually ALL of the invasion force are now dead-- meaning little of the lessons of combat can be passed to newly inducted troops during their initial military training. The burn rate in Ukraine is so intense that virtually no troops are rotated and almost none are order home to oversee the training of freshly inducted troops. Some new soldiers arrive in Ukraine with less than 2 weeks of formal military training. Like the officers who lead them, these troops lack military competency. Badly trained troops led by incompetent officers is a recipe for defeat. Incapable of preforming complex military evolutions, Russia relies on costly daylight assaults. These attacks follow one after another, using the same axes of attack, against the same objectives, often at the same time of day—day after day. Russia frequently loses as much as 80 or even 100% of these assault elements. This is an unbreakable doom loop of poor training, poor execution and poor leadership.

3) Russian officers do not care how many troops they lose. To a Russian general, his men are a ‘consumable’, expended like ammunition. Instead of trying to preserve the vital resource of well-trained troops, Russian officers expend them in meat wave attacks. With little chance to survive more than a month of the zero line, there are no ‘old soldiers’ to teach freshly arriving troops. Each new unit starts at zero. Zero experience, Zero leadership, and zero chance for success. Where Russia has made gains, it has done so at prohibitive cost. Nearly 70,000 killed in Bakhmut, 50,000 in Kreminna, and 60,000 in the Donetsk offensive. This loss rate is unsustainable.

4) Bad equipment. Russian tanks are notorious for exploding with a single hit. Likewise their infantry fighting vehicles and personnel carriers. Because of the use of ammunition carousels in the crew compartments (meaning vehicle crews are literally sitting on ammo) these vehicles are death traps. This problem is endemic and cannot be remedied as it would require page one redesigns of entirely new classes of vehicles. Which would have to be prototyped, tested and manufactured with increasingly scarce materials. It takes decades to create new classes of vehicles. An example is Russia’s ‘super tank” the T-14 Armada. It isn’t ready for prime time, and not one is known to have participated in combat in Ukraine. Ground maneuver warfare requires functional, tough main battle tanks and IFVs working in concert. Tanks that cannot survive a single hit is a problem. Armored personnel carriers that are so poorly designed that troops refuse to ride inside them but take their chances raisin atop the vehicle exposed to shell, shot and blast effect; is a problem. This not only diminishes Russian combat effectiveness but makes it nearly impossible for Russia to use any other tactic than ‘mass’, which leads to mass casualties. This isn’t a war that Russia can win. It is a quagmire, like Vietnam, except the US never lost a thousand men a day— which Russia does daily. The US lost 50,000 men in Vietnam in 10 years of conflict. Russia has lost 700,000 in three years— 14 times the casualties of the US, in one third the time.

https://x.com/ChuckPfarrer/status/1853477159232208971


7,931 posted on 11/04/2024 8:50:23 AM PST by FtrPilot
[ Post Reply | Private Reply | To 7930 | View Replies]

To: FtrPilot

2) (Chuck could add) Many of the troops riding are highly trained - in other specialties like radar, missile battery operators, tank crews, etc.

This casual attitude leads to the loss of highly trained people in the more critical military specialties, and a huge loss in money spent to train them up to a certain skill level in their specialty.


7,932 posted on 11/04/2024 9:34:37 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7931 | View Replies]

Comment #7,933 Removed by Moderator

Comment #7,934 Removed by Moderator

To: bimboeruption
“I wish I knew how to quit you.”


7,935 posted on 11/04/2024 3:54:36 PM PST by Allegra (“As I was saying…”)
[ Post Reply | Private Reply | To 7933 | View Replies]

There must be a missing fence somewhere…


7,936 posted on 11/04/2024 3:59:12 PM PST by Allegra (“As I was saying…”)
[ Post Reply | Private Reply | To 7935 | View Replies]

Comment #7,937 Removed by Moderator

To: bimboeruption
Wtf is up with you, self proclaimed Christian, and the homoerotica/gay crap you continuously post here?

Less gay propaganda would be appreciated!

7,938 posted on 11/04/2024 8:07:37 PM PST by GBA (Endeavor to persevere. Onward through the fog …)
[ Post Reply | Private Reply | To 7937 | View Replies]

To: GBA

>>>>Wtf is up with you, self proclaimed Christian, and the homoerotica/gay crap you continuously post here?

Less gay propaganda would be appreciated!<<<<

And what’s up with you, self-proclaimed Christian, using foul language on this site?

Less profanity would be appreciated!


7,939 posted on 11/04/2024 8:33:21 PM PST by bimboeruption (“Less propaganda would be appreciated.” JimRob 12-2-2023)
[ Post Reply | Private Reply | To 7938 | View Replies]

To: FtrPilot; SpeedyInTexas; PIF; AdmSmith; blitz128; marcusmaximus; ETCM; ansel12; ...

On the eve of our election, May God kindly hear our prayer, to protect our Nation, and all of God’s children on this Earth, from those who would lead us astray, or do us harm. May God grant us peace and justice, especially for the people of Ukraine and Russia, Israel and Iran. In Jesus’s name we pray.


7,940 posted on 11/04/2024 9:11:51 PM PST by BeauBo
[ Post Reply | Private Reply | To 7929 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 7,901-7,9207,921-7,9407,941-7,960 ... 20,201-20,212 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson