Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 7,761-7,7807,781-7,8007,801-7,820 ... 22,001-22,012 next last
To: SpeedyInTexas

I yearn for the days of Reagan and Bush Sr.


I’ll take Eisenhower for $100


7,781 posted on 10/31/2024 2:15:57 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7780 | View Replies]

To: PIF

JD loaded his guns and stood guard at his door.

Either he is crazy or a bull crap story teller.

Maybe both.


7,782 posted on 10/31/2024 3:46:32 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7781 | View Replies]

To: PIF
“Nate Silvers posting last hour. The numbers exactly match my last prediction. Willie Brown’s mistress wins popular vote by 1%. Trump takes PA, NV, AZ,GA. Willie Brown’s mistress takes WI, MI.”

But big note is how ALL states have moved in Trumps direction in the last month




7,783 posted on 10/31/2024 4:12:06 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7782 | View Replies]

To: SpeedyInTexas

Not buying NM and NH numbers heels up may win but not by those numbers


7,784 posted on 10/31/2024 4:32:10 PM PDT by blitz128
[ Post Reply | Private Reply | To 7783 | View Replies]

Russian Offensive Campaign Assessment, October 31, 2024

The South Korean government reportedly intends to send an unspecified number of South Korean personnel to Ukraine to monitor North Korean troops. South Korean newspaper Hankyoreh reported on October 31 that a senior South Korean presidential office official stated on October 30 that South Korea has a “legitimate need” to analyze North Korean military activities in the war in Ukraine and “feels the need” to establish a team to monitor North Korean troops and the battlefield situation.[4] South Korean Defense Minister Kim Yong-hyun reportedly stated on October 31 that the South Korean defense minister can make the decision about the monitoring team's deployment without parliamentary approval. South Korea's Yonhap News Agency reported on October 22 that a South Korean government source stated that South Korea was considering sending South Korean military personnel, likely from intelligence units, to Ukraine to monitor North Korean forces’ tactics and combat capabilities and to question captured North Koreans.[5] Ukrainian President Volodymyr Zelensky stated on October 29 that he discussed enhanced intelligence cooperation with South Korean President Yoon Suk Yeol.[6]

The Russian military command continues to commit seriously wounded personnel to highly attritional infantry-led “meat” assaults in the Kurakhove direction as Russian President Vladimir Putin attempts to posture himself as deeply concerned with the medical treatment of Russian veterans. A former Russian Storm-Z instructor and milblogger amplified reports accusing the Russian military command of committing wounded personnel of a medical company belonging to the 57th Motorized Rifle Regiment (20th Motorized Rifle Division, 8th Combined Arms Army [CAA], Southern Military District [SMD]) to the frontlines in the Kurakhove direction.[15] The milblogger summarized that the Russian military command failed to provide adequate medical treatment to the wounded personnel and instead held them hostage in a “medical basement.” The Russian military command reportedly demanded bribes of 1.5 million rubles ($15,459) to release the wounded personnel from the basement and claimed that there are not enough people to support assault operations in the Kurakhove direction.[16] The milblogger noted that the Russian military command transferred wounded personnel to the frontlines to fight as part of assault companies. The milblogger stated that although Russian officials immediately responded to these complaints, closed the “medical basement,” and transferred the remaining wounded personnel to hospitals, the practice of detaining wounded personnel in “medical basements” persists among other Russian military units that are fighting on different sectors of the front, such as the Russian 109th Rifle Regiment (132nd Motorized Rifle Brigade, 51st CAA, formerly 1st Donetsk People's Republic Army Corps [DNR AC]) operating in the Toretsk direction. The milblogger emphasized that the Russian military command is committing wounded personnel and specialists to assaults because it relies on “meat” assaults to sustain the tempo of Russian advances, resulting in heavy Russian manpower losses. Putin highlighted during a meeting with the Russian government on October 31 that he recently met with disabled Russian veterans who told Putin they were satisfied with government care and benefits, but tasked the Russian Ministry of Defense (MoD) and Presidential Administration to increase government support for disabled veterans, stating that government efforts in this sphere are “not enough.”[17]

The Moldovan Constitutional Court confirmed on October 31 the passing of the October 20 European Union (EU) referendum with a 50.72 percent turnout rate.[18]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-october-31-2024

7,785 posted on 11/01/2024 12:30:51 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7750 | View Replies]

The meat grinder is working hard - more than 1 Russian/minute


7,786 posted on 11/01/2024 12:45:05 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7766 | View Replies]

To: PIF; gleeaikin
Fraudsters have begun distributing a Trojan virus through Telegram channels on finance and trading. They steal data and spy on users, Kaspersky Lab warned. Hackers attach archives with malicious files to Telegram posts. If the user opens them, malware will be downloaded to the device — the DarkMe virus, which allows remote execution of commands from the attackers’ server and stealing data.

https://t.me/bankrollo/33896

Not the only malicious code in Telegram

7,787 posted on 11/01/2024 1:11:52 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7786 | View Replies]

To: SpeedyInTexas

And your prediction based on that polling data for the winner of the Electoral College and Presidency is?


7,788 posted on 11/01/2024 5:51:04 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7783 | View Replies]

To: PIF

7,789 posted on 11/01/2024 5:54:54 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7788 | View Replies]

To: PIF; All

46 Good RuZZians

“How Wagner’s Ruthless Image Crumbled in Mali”

“The Russian mercenary group operated with little pushback in the West African nation — until it launched one of its most ambitious missions.”

“For years, Russia has promoted the Wagner mercenary group to authoritarian leaders in Africa as a force of fearsome warriors who could protect leaders’ grip on power and help their armies reclaim territories from armed groups.

In return, Moscow has gained access to resource-rich countries, dislodged Western and U.N. troops and seeded influence across West and Central Africa to a degree not seen since the fall of the Soviet Union.

But a major defeat for Wagner this summer in northern Mali showed that its actual capabilities might be overstated and unable to meet the ambitions of one of the group’s closest African partners. The New York Times confirmed the deaths of at least 46 Wagner fighters and 24 allied Malian soldiers by matching details seen in footage of the corpses, such as uniforms and tattoos, with imagery of the soldiers when they were alive.”

https://archive.ph/Wh4fe


7,790 posted on 11/01/2024 5:56:50 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7789 | View Replies]

To: SpeedyInTexas

How The Army Will Use Its Super Integrated Air Defense System
Branded Content: Northrop Grumman’s Bill Lamb provides an in-depth look at the soon-to-be-fielded Integrated Battle Command System.

https://www.twz.com/sponsored-content/how-the-army-will-use-its-super-integrated-air-defense-system

and ironically, the vaulted system above is reflected domestically by:

Lasers, Microwaves, Missiles, Guns Not On The Table For Domestic Drone Defense
Policy hurdles are limiting what capabilities the U.S. military can even consider to help provide critical domestic anti-drone defenses after years of inaction.

https://www.twz.com/news-features/lasers-microwaves-missiles-guns-not-on-the-table-for-domestic-drone-defense


The US cannot by policy and by law defend against drones.
“This all, in turn, raises questions about the potential for serious gaps in the currently allowable, but still largely non-existent domestic drone defense ecosystem.”


7,791 posted on 11/01/2024 5:57:20 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7783 | View Replies]

To: SpeedyInTexas

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ 80% Death Rate. Russian Mission Goes Terribly Wrong ]


Today [ Nov 01 ], there are a lot of important updates from the Kurakhove direction.

Here, after months of intense clashes, the Russian forces approached the town of Kurakhove, launching large attacks with the purpose of entering this important stronghold. Ukrainians understand the importance of this settlement, which is why they prepared to effectively counter the planned Russian advance.

After months of fighting in this area, Russian forces consolidated their positions: in settlements east of Kurakhove, in particular Maskimiliyanivka and Ostrivske. These two villages, both in close proximity to Kurakhove, provided a critical staging ground that enabled Russians to prepare for the first assaults on Kurakhove itself.

The Russian strategy aimed to amass a large number of tanks, BMPs, and armored transports to swiftly deploy forces to the town’s outskirts and secure a foothold.

This plan anticipated significant losses for the armored units, whose primary role was to support and protect infantry in open fields en route to the town, as their effectiveness would diminish in urban combat. Once inside the settlement, Russian stormtroopers would dismount to engage in intense close-quarters fighting for control of the area.

The fields surrounding Kurakhove have been heavily fortified by Ukrainian fighters, featuring extensive trench networks, anti-tank ditches, and dragon’s teeth to deter Russian advances.

The sole asphalt road leading to the eastern part of the town has been further obstructed by Ukrainian defenses, making it the main target of Russian preparations for the assault. Intense Russian artillery shelling, along with airstrikes, has partially weakened and damaged the Ukrainian fortifications in the area.

This included the dragon’s teeth blocking the road to the town, which had been damaged, creating a partial opening. Anticipating an imminent Russian attack and knowing that mining the area would be time-consuming, the Ukrainians drove an old tank to seal the gap in the line of damaged dragon’s teeth, keeping the road impassable for Russian forces.

Russian drone operators spotted this and, in response, dispatched a tank crew on motorcycles to capture the abandoned Ukrainian tank. The Russian tank crew managed to start the vehicle and used it to crush a couple more dragon’s teeth. However, Ukrainian fighters quickly detected the situation and struck the captured tank, forcing the Russians to abandon it and preventing further damage to their defenses.

Despite this, the Russian command quickly deployed an assault formation consisting of 2 tanks, 5 BMPs, and over 60 stormtroopers divided into 2 platoons. Anticipating that the Russians would attempt to advance along the same road where they had previously tried to dismantle the dragon’s teeth, the Ukrainians were prepared to counter the attack. The 2 Russian tanks led the assault, targeting the remaining Ukrainian fortifications, clearing the way for the BMPs carrying stormtroopers into Kurakhove.

At the same time, the tanks aimed to draw FPV drone strikes and artillery fire onto themselves, using their thick armor to absorb the hits so the BMPs could reach their destination safely. Unfortunately for the Russians, 4 out of 5 BMPs were destroyed by drones, while the squad of stormtroopers that did reach Kurakhove found themselves pinned down in a house under constant drone surveillance.

Overall, despite losing 80% of their stormtroopers, the Russians managed to advance along the road and enter the eastern outskirts of Kurakhove, indicating weak control of the area due to severe losses.

While they established a presence, Russian forces faced significant tactical disadvantages. The road leading to the town remains their only supply route to these new positions, and the gap in the dragon’s teeth line can be further undermined through remote mining, potentially jeopardizing their hold on the area.

Consequently, the surviving Russian stormtroopers in the eastern outskirts risk being cut off from supplies, which could either force them to withdraw or leave them vulnerable to destruction in a Ukrainian counterattack.


7,792 posted on 11/01/2024 6:06:00 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7790 | View Replies]

To: SpeedyInTexas

Hope you are going to be correct.


7,793 posted on 11/01/2024 6:06:52 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7789 | View Replies]

To: SpeedyInTexas

I remember that story - dead mercs everywhere.


7,794 posted on 11/01/2024 6:08:04 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7790 | View Replies]

To: PIF; All

Still Skeptical

“Iran Warns It Will Retaliate for Israel’s Attack”

“Comments by a top military official raise the risk of further escalation between the two foes”

“Iran is signaling it will respond to last weekend’s Israeli strikes on its soil, a move that would extend the cycle of violence between the two enemies and risk dragging the Middle East into a wider war.

Iran initially played down Saturday’s strike, which Israel aimed to calibrate to close out a series of direct attacks this year by the two sides. But the nature of the attack, which damaged Tehran’s most advanced air defenses and killed four soldiers, is now prompting more definitive talk of an Iranian retaliation.

“We will give an unimaginable response to the enemy,” Gen. Hossein Salami, the head of Iran’s Islamic Revolutionary Guard Corps, said Thursday after days of bellicose statements by senior Iranian officials. “

https://www.wsj.com/world/middle-east/iran-warns-it-will-retaliate-for-israels-attack-82abf476?mod=hp_lead_pos6


7,795 posted on 11/01/2024 6:50:21 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7790 | View Replies]

To: PIF; All

“Iran preparing major retaliatory strike from Iraq within days, Israeli intel suggests”

“Israeli intelligence suggests Iran is preparing to attack Israel from Iraqi territory in the coming days, possibly before the U.S. presidential election, two Israeli sources tell Axios.

Why it matters: Israel and Iran have been engaged in an escalating tit-for-tat for weeks. Carrying the attack out through pro-Iranian militias in Iraq and not directly from Iranian territory could be an attempt by Iran to avoid another Israeli attack against strategic targets in Iran.

Driving the news: The sources said Israeli intelligence suggests the attack is expected to be carried out from Iraq using a large number of drones and ballistic missiles.

Iran could quickly put its preparations into action if Tehran decides to strike soon, but the U.S. doesn’t know if that decision has been made, a U.S. official told Axios.

What they’re saying: Iranian Revolutionary Guard Corps commander Hossein Salami said on Thursday that Israel made a mistake when it attacked Iran last week and stressed that Iran’s response will be “different from any scenario” Israel might expect.

A high-ranking Iranian source told CNN that Iran is planning a “definitive and painful” response that will likely come before the election, the network reported Wednesday.

Mohammad Mohammadi Golpayegani, chief of staff to Iran’s supreme leader, told TV network al-Mayadeen on Thursday Iranian retaliation was “certain.” He said the Iranian response will be “strong” and will “make our enemy regret” its attack.”


7,796 posted on 11/01/2024 6:58:58 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7795 | View Replies]

To: PIF; All

CLUSTERed

“Aerial reconnaissance unit “Skyforce” of the 108th Territorial Defense Brigade spotted and directed a HIMARS and cluster artillery strike on a group of ~40 Russian forces in Zaporizhzhia region. The strike resulted in at least 10 Russian casualties and destroyed a GAZ vehicle.”

https://x.com/NOELreports/status/1852334074792214762


7,797 posted on 11/01/2024 7:22:55 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7796 | View Replies]

To: PIF; All

“Russia high likely lost another fighter jet. Russian Air Force affiliated channel Fighterbomber with a mourning message, showing the image of a Su-34 Fullback. “

https://x.com/NOELreports/status/1852262383407820827


7,798 posted on 11/01/2024 7:25:45 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7797 | View Replies]

To: PIF; All

“Last night Russians complain that Ukraine shot down an air target over the Russian region of Belgorod with a Patriot system, Russian military blogger Fighter bomber says they lost an Su34.”

https://x.com/JayinKyiv/status/1852319538513162424


7,799 posted on 11/01/2024 7:34:34 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7798 | View Replies]

To: PIF; All

“Poland plans to buy more than 100 more 🇺🇸US MLRS HIMARS to the 486 previously ordered”

https://x.com/front_ukrainian/status/1852102519620800834


7,800 posted on 11/01/2024 7:36:47 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7799 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 7,761-7,7807,781-7,8007,801-7,820 ... 22,001-22,012 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson