Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 7,481-7,5007,501-7,5207,521-7,540 ... 19,521-19,535 next last
To: gleeaikin

Norks will be sent to Kursk for counteroffensive. Putin just pushed back the deadline for Russia to retake captured Kursk territory to Feb 1 with another deadline for Russia to create a buffer zone in Ukraine in Sumy region to protect Kursk by Feb 25.


7,501 posted on 10/23/2024 1:15:57 PM PDT by marcusmaximus
[ Post Reply | Private Reply | To 7498 | View Replies]

To: PIF

Ak and Pa will go Trump and Va will be won by heels up by the slimmest of margins 2-3 points


7,502 posted on 10/23/2024 2:47:10 PM PDT by blitz128
[ Post Reply | Private Reply | To 7495 | View Replies]

To: SpeedyInTexas

Wouldn’t count out MI or WI


7,503 posted on 10/23/2024 2:49:05 PM PDT by blitz128
[ Post Reply | Private Reply | To 7494 | View Replies]

To: PIF; All

American Traitor. Some of his work has been spread on FR.

“American creating deepfakes targeting Harris works with Russian intel, documents show”

“Russian documents reviewed by The Post expose the workings of a Moscow network that has become a potent source of fake news targeting American voters.”

“A former deputy Palm Beach County sheriff who fled to Moscow and became one of the Kremlin’s most prolific propagandists is working directly with Russian military intelligence to pump out deepfakes and circulate misinformation that targets Vice President Kamala Harris’s campaign, according to Russian documents obtained by a European intelligence service and reviewed by The Washington Post.

The documents show that John Mark Dougan, who also served in the U.S. Marines and has long claimed to be working independently of the Russian government, was provided funding by an officer from the GRU, Russia’s military intelligence service. Some of the payments were made after fake news sites he created began to have difficulty accessing Western artificial intelligence systems this spring and he needed an AI generator — a tool that can be prompted to create text, photos and video.

Dougan’s liaison at the GRU is a senior figure in Russian military intelligence working under the cover name Yury Khoroshevsky, the documents show. The officer’s real name is Yury Khoroshenky, though he is referred to only as Khoroshevsky in the documents, and he serves in the GRU’s Unit 29155, which oversees sabotage, political interference operations and cyberwarfare targeting the West, according to two European security officials who spoke on the condition of anonymity to discuss sensitive intelligence.”

https://archive.md/cOy6X


7,504 posted on 10/23/2024 7:31:13 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7503 | View Replies]

To: SpeedyInTexas
American Traitor. Some of his work has been spread on FR.

There are people on FR that cheer Russia, China and Iran. All hail BRICs, death to America. To them, he is a hero.

7,505 posted on 10/24/2024 1:16:09 AM PDT by ETCM (“There is no security, no safety, in the appeasement of evil.” — Ronald Reagan)
[ Post Reply | Private Reply | To 7504 | View Replies]

Russian Offensive Campaign Assessment, October 23, 2024

The adoption of the Kazan Declaration on the second day of the BRICS summit in Kazan, Republic of Tatarstan on October 23 demonstrated that Russia has not yet secured the international support nor created the alternative security structure that the Kremlin desires. The Kazan Declaration notably only mentioned Russia's war in Ukraine once.[1] The declaration states that all signatories should act in accordance with the principles of the UN Charter — including the provision on respect for territorial integrity — and that BRICS states welcome “relevant” offers of mediation aimed at ensuring a peaceful settlement of the war through dialogue and diplomacy. Ukraine has emphasized that the “principles of the UN Charter” is a main avenue through which Ukraine can achieve peace and highlighted the illegality of Russia's war under international law.[2] The Ukrainian Ministry of Foreign Affairs (MFA) responded to the Kazan Declaration, stating that it shows that Russia failed to “export” its views on changing the world order and global security architecture to BRICS summit participant states.[3] The Ukrainian MFA stated that the declaration also demonstrates that BRICS states are not unified around Russia's war against Ukraine, likely since many of these countries support the UN Charter's principles. Ukraine's Foreign Intelligence Service similarly assessed that the BRICS summit will not result in the international community's approval of an alternative system of international settlements that Russia wants and stated that India, the United Arab Emirates (UAE), Brazil, and South Africa opposed the transformation of BRICS into an anti-US coalition.[4]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-october-23-2024

7,506 posted on 10/24/2024 1:39:57 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7486 | View Replies]


7,507 posted on 10/24/2024 2:01:23 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7490 | View Replies]

To: SpeedyInTexas

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ No Turning Back. Ukrainians Face a Massive Wave of Attacks! ]


Today [ Oct 24 ], the biggest developments come from the Kursk direction.

Amid intensifying Russian counterattacks, Russian forces escalated their efforts by launching large pincer maneuvers designed to encircle and eliminate cut-off Ukrainian positions. In a swift and calculated response, Ukrainian forces launched devastating drone strikes on advancing Russian units and deployed elite Marines for cover, setting the stage for the decisive battle.

As you know, as part of their counteroffensive, Russians launched a spearhead attack along the hardened road between Korenevo and Sudzha, whereupon Ukrainians pulled back from several exterior positions to avoid complete encirclement. Russians continued to launch armored assaults over the highway however, trying to consolidate their gains, and maintain control over the crucial supply line.

As there were no other roads leading into the Ukrainian-controlled town of Olgovka, this put Ukrainian soldiers here in an increasingly precarious position and largely cut off from supplies and reinforcements.

Ukrainian soldiers here were also under threat of Russian assaults from all sides, as Russians controlled all hardened roads leading into the settlement. As Ukrainians continue to prioritize the survival of their men, keeping a mentality of living to fight another day, Ukrainian commanders ordered the immediate withdrawal of their forces from Olgovka.

Similarly, the Russian spearhead had reached an important intersection between Novoivanovka and Liubimovka. This also caused Ukrainian soldiers defending Liubimovka to lose access to their main supply road. Russians knew this and decided to press their advantage, as Russian soldiers in Liubimovka started actively assaulting Ukrainian positions to increase the pressure.

As you know, Ukrainians launched frontal attacks on Novoivanovka and had reclaimed most of the settlement from the Russians. Still, Russians continued to launch armored assaults over the highway to Sudzha, preventing Ukrainians from re-establishing control over the intersection, and ground lines of communication with the soldiers stuck in Liubimovka.

Russians also moved in several armored vehicles from the west, trying to deploy groups of infantry to pin down Ukrainians in the settlement, preventing them from breaking out. Due to bad weather and Russian electronic warfare equipment making it difficult for Ukrainian drone operators to successfully hit their targets, Ukrainians deployed a new technology.

Ukrainians had programmed several FPV kamikaze drones with target recognition software, meaning the drone operator only had to fly and lock on to a target, whereafter the drone autonomously flies on and hits the target.

This bypasses Russian electronic warfare systems, which only work by severing the drone operator’s connection to the drone, which the autonomous FPV drone does not need.

While not all Ukrainian FPV drones are yet equipped with this technology, Ukrainians were still able to destroy a large number of Russian vehicles and infantry trying to enter the settlement. In their hurry to report about their successful capture of the village and high Ukrainian losses, Russian channels even accidentally showed a destroyed Russian column of vehicles, thinking they were Ukrainian.

The Russian drone operator had mistakenly identified the Russian vehicles as an American Bradley, Abrams, and several MRAP armored vehicles, and had proudly shown off their burning remains. Expectedly, the video was later deleted from their channel, but not before being picked up by Ukrainians.

Due to bad weather conditions and dense fog, Russians were still able to use their armored vehicles to deploy a decent amount of infantry in the settlement. These Russian infantry groups quickly continued their assaults against the undersupplied Ukrainian units still stuck in Liubimovka.

Ukrainians were horribly outmatched, as a Ukrainian officer in Kursk reported that they were outnumbered 5 to 1 in terms of manpower. In these conditions, Ukrainians had no option but to withdraw to more defensible positions in the settlements and behind the rivers.

Ukrainian commanders sent in a team of highly skilled Marines to cover the retreat of a group of Ukrainian soldiers that had been fighting in the town for days on end with many of them wounded. The Ukrainian Marines, despite only being a group of nine soldiers faed faced off against dozens of Russians who quickly overran their oppositions.

Faced with a difficult decision the Marines then called in artillery fire right on their own position, to take as many Russian soldiers with them as they could. As heavy artillery shells and cluster munitions rain down on their position the house they were hiding in took a direct hit and caught on fire and the Marines were presumed dead.

However, by nothing short of a miracle all the Marines made it back to camp Al even picking up another wounded soldier on their way. In the end, Ukrainians had to use the forests and tree lines to safely withdraw back to more defensible positions deeper in the salient.

The ability of Russian forces to cut off key supply lines and maintain pressure on Ukrainian positions with armored assaults, has placed Ukrainian troops in increasingly vulnerable situations. Despite innovative counter measures like autonomous FPV drones, Ukrainian forces have had to conduct strategic withdrawals from key areas to avoid encirclement.

However, even in dire circumstances, Ukrainian resilience remains prominent in battle, as can be seen by the Marines remarkable actions and survival under heavy Russian assault. With weather conditions deteriorating control over hardened roads will play a decisive role in shaping the front lines in the coming months.


7,508 posted on 10/24/2024 5:10:34 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7504 | View Replies]

To: FtrPilot

French Mirage 2000s Destined For Ukraine Will Fly With Storm Shadow, MICA Missiles
Ukraine Situation Report: The first three Mirage 2000s are expected to arrive in Ukraine by March.
https://www.twz.com/news-features/french-mirage-2000s-destined-for-ukraine-will-fly-with-storm-shadow-mica-missiles


North Korean Troops In Russia Finally Confirmed By NATO, U.S.
The acknowledgment comes after South Korea and Ukraine claimed that North Koreans are undergoing training in Russia to support the war effort.
https://www.twz.com/news-features/north-korean-troops-in-russia-finally-confirmed-by-nato-u-s


7,509 posted on 10/24/2024 5:13:26 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 7508 | View Replies]

To: SpeedyInTexas

Harris doesn’t need any “deep fakes” her own performance couldn’t be worse, next we will hear that her CNN,Fox, 60 minutes, daddy… were all Russian propaganda 😎


7,510 posted on 10/24/2024 5:48:13 AM PDT by blitz128
[ Post Reply | Private Reply | To 7504 | View Replies]

To: PIF; All

I think Nevada is the canary in the coal mine for Willie Brown’s mistress.

Ds usually have a 40k advantage from early voting. Rs are leading after 5/14 days.

RuZZian disinfo people are happy.

Chinese disinfo people are sad.

“Statewide GOP lead: 17,000, or 4.2 percent

Clark firewall: Just under 7,000, or 4.5 percent

Statewide overall turnout: 409,000, or 20 percent

If turnout is 1.4 million, nearly 30 percent of the vote is in.”

https://thenevadaindependent.com/article/the-early-voting-blog-2024


7,511 posted on 10/24/2024 6:16:05 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7510 | View Replies]

To: PIF; All

(leftist) Jon Ralston:

“SOS is reporting today’s ballots, and I now feel like I am in the upside-down world. In past cycles, I would be telling you how the Dems were slowly building a firewall in Clark (tens of thousands more ballots than Republicans). They have successfully done this in every presidential election since 2008.

But the opposite is happening: Thanks to a rural tsunami, the GOP has moved out to a substantial ballot lead:”

“There is no good news in these numbers for Dems, who are basing their hopes on a deluge of mail ballots coming in during the final days and perhaps the day or two after the election (They can be counted for four days after Nov. 5.) and a very favorable split among indies in urban Nevada.”


7,512 posted on 10/24/2024 6:20:29 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7511 | View Replies]

To: PIF; All

BRICS, RICKS, DICKS

“Russia Pushes for BRICS Clearing, Depository System to Sidestep the West”

BUT

“Most BRICS countries have great economic ties with the Western world,” he said. They won’t want to separate from it.”

https://www.bloomberg.com/news/articles/2024-10-24/russia-pushes-for-brics-clearing-depository-system-to-sidestep-the-west?srnd=homepage-americas


7,513 posted on 10/24/2024 6:25:01 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7512 | View Replies]

To: PIF; All

China thinks Trump will win

“A potential Donald Trump victory and economic troubles at home have prompted China to embark on a charm offensive, particularly with US allies and partners.

From proclaiming a desired “fresh start” with Japan to a detente with India, Chinese officials have sought to dial down diplomatic friction days ahead of the US presidential election. Beijing has also signaled its intent to improve ties with the UK and Australia, a seeming departure from the kind of combative diplomacy it became famous for during Trump’s first term.

The diplomatic overtures underscore changing political calculations by Beijing — and its counterparts — in anticipation of a possible return of an unpredictable US president. They may help China buffer against economic turbulence from a man who has vowed to impose tariffs at levels that would decimate commerce between the top powers and levied trade threats even at his country’s allies.”


7,514 posted on 10/24/2024 6:34:36 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7513 | View Replies]

To: gleeaikin; marcusmaximus; Paul R.; Bruce Campbells Chin; PIF; familyop; MercyFlush; tet68; ...
Ukraine ping

There's a Telegram post on a Russian father and two sons KIA, one after another. If true, this may be testament to the unsentimental way the Russians are using recruits. While Saving Private Ryan is fiction, there was some effort at the DOD to spare families the trauma of having their entire male lines eliminated.


7,515 posted on 10/24/2024 6:41:01 AM PDT by Zhang Fei (My dad had a Delta 88. That was a car. It was like driving your living room)
[ Post Reply | Private Reply | To 7498 | View Replies]

To: PIF; All

250,000 rounds of ammo. I have like 100 rounds in my house...

“An Arizona prosecutor said the man arrested in the shooting of a Democratic National Committee office in suburban Phoenix had more than 120 guns and over 250,000 rounds of ammunition in his home, leading law enforcement to believe he may have been planning a mass casualty event.

Maricopa County prosecutor Neha Bhatia said at Jeffrey Michael Kelly’s initial court appearance on Wednesday that federal agents told her about the large seizure made after Kelly’s arrest. Scopes, body armor and silencers were also found, she said. A machine gun was discovered in the car he was driving.

The sheer size of the cache led authorities to believe “this person was preparing to commit an act of mass casualty,” Bhatia said.

Police said Kelly, 60, allegedly fired BB pellets and then gunshots at the glass front door and a window of the Arizona Democrats’ field office in Tempe. Police found three .22-caliber bullet casings while searching Kelly’s trash, according to court documents.”


7,516 posted on 10/24/2024 6:44:16 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7514 | View Replies]

To: Zhang Fei

Good feel story of the day


7,517 posted on 10/24/2024 6:44:57 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7515 | View Replies]

To: SpeedyInTexas

[250,000 rounds of ammo. I have like 100 rounds in my house...]


A hoarder focused on guns and ammo. Probably a little paranoid. A lot of women would hoard clothing, but they run out of closet space, so Goodwill and the Salvation Army benefit. 250K .22LR rounds is 500 boxes of 500 (in inches, 2.63 x 2.63 x 2.50), wouldn’t even fill a closet, pencils out at 5 cubic feet. At 4¢ a round pre-pandemic, $10K total.

https://www.upcindex.com/47700481906


7,518 posted on 10/24/2024 7:11:23 AM PDT by Zhang Fei (My dad had a Delta 88. That was a car. It was like driving your living room)
[ Post Reply | Private Reply | To 7516 | View Replies]

To: Zhang Fei; SpeedyInTexas; AdmSmith; PIF; blitz128; USA-FRANCE; FtrPilot; BroJoeK; BeauBo; ...

A tragedy for this Russian family, but not as bad as for the Sullivan family.

Yes, five brothers from Waterloo, Iowa were killed in action during World War II while serving aboard the USS Juneau, which was torpedoed and sunk on November 13, 1942:
* George Thomas: Gunner’s Mate 2nd Class, 27 years old
* Francis “Frank” Henry: Coxswain, 26 years old
* Joseph “Joe” Eugene: Seaman 2nd Class, 24 years old
* Madison “Matt” Abel: Seaman 2nd Class, 23 years old
* Albert “Al” Leo: Brother of Genevieve Marie
The brothers enlisted in the Navy in 1937 and 1942, with the condition that they stay together. They joined the Juneau’s commissioning crew in February 1942 and remained with the ship through the Guadalcanal Campaign.
The Sullivan brothers’ deaths were the greatest combat-related loss of life by a single family in American military history. The tragedy led to a new Navy policy that discouraged family members from serving together on the same ship. In honor of the brothers, the Navy named its next ship the The Sullivans (DD-537).

I pray this war ends soon, for all the soldiers currently at war, and so my 2 grandsons, enlisted last year will not be casualties somewhere, some day.


7,519 posted on 10/24/2024 7:24:24 AM PDT by gleeaikin ( Question authority as you provide links)
[ Post Reply | Private Reply | To 7515 | View Replies]

To: PIF; All

“The 🇺🇦Ukrainian 425th Assault Battalion «Skala» inflicts heavy casualties on 🇷🇺Russian invaders in the Pokrovsk direction.”

https://x.com/GloOouD/status/1849423755614838884


7,520 posted on 10/24/2024 7:26:55 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 7514 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 7,481-7,5007,501-7,5207,521-7,540 ... 19,521-19,535 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson