Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 6,761-6,7806,781-6,8006,801-6,820 ... 19,201-19,219 next last
To: SpeedyInTexas; PIF
After failed attacks and heavy losses in armored vehicles, Russians are now forced to use "Niva" cars, the so-called "pride" of their auto industry, for assaults.

They transport assault groups to the attack line, and then the infantry proceeds on foot.

This footage shows the repelling of another Russian assault.

https://x.com/NOELreports/status/1840763208023339088


6,781 posted on 09/30/2024 8:25:35 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 6777 | View Replies]

To: FtrPilot
"Russians are now forced to use "Niva" cars, the so-called "pride" of their auto industry, for assaults."

Lada Niva Legend. They get battlefield test drive of the model they would like their family to get as a reward.

6,782 posted on 09/30/2024 8:31:29 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6781 | View Replies]

To: PIF
Today Russian forces launched a major attack on the Kharkiv front, in the town of Vovchansk:

From the Russian side 17 MT-LB, 3 tanks and more than 100 infantry were involved in the assault operations in the Vovchan direction.

16 MT-LBs were destroyed, 1 tank was knocked out, which was able to retreat together with survivors.

As said by Ukrainian soldier: “The boys confidently met Russian armor in the Vovchansk front, as I said, the units were ready for this, so they worked confidently.

In addition to the destroyed iron, there are a lot of corpses lying around them, since almost all the boxes were with infantry.”

https://x.com/bayraktar_1love/status/1840752348676723077

16 out of 17 MT-LBs were destroyed.

Without a doubt, UKF were prepared for this assault.

ruzzian OPSEC/COMSEC is non-existent.

6,783 posted on 09/30/2024 8:32:05 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 6781 | View Replies]

To: PIF; All

RuZZia-Wood

“Despite most of the Russian elite having already acquired western citizenships, homes and banking, convincing regular Russians that the West is hell on earth is a primary goal of Russia’s domestic propaganda apparatus.

Some behind the scenes footage of the newest Russian “docudrama” of Russian spy, Maria Butina’s time in America is yet another hilarious example.”

https://x.com/StratcomCentre/status/1840774787532050877


6,784 posted on 09/30/2024 10:22:50 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6783 | View Replies]

To: SpeedyInTexas

Russia Training To Launch FPV Drones From Helicopters To Counter Sea Drones
Deploying and controlling FPV drones from helicopters would be highly beneficial, allowing for rapid response with very flexible and inexpensive guided weapons.
https://www.twz.com/news-features/russia-training-to-launch-fpv-drones-from-helicopters-to-counter-sea-drones


Russian Su-35 Shown ‘Headbutting’ American F-16 At Very Close Range Off Alaska
The incident, which NORAD deemed “unprofessional,” occurred off Alaska during an intercept by F-16Cs of two Tu-95 Bears and their escorts.
https://www.twz.com/air/russian-su-35-shown-headbutting-american-f-16-at-very-close-range-off-alaska


6,785 posted on 09/30/2024 12:53:13 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6784 | View Replies]

To: PIF; All

The African Corp

https://x.com/GloOouD/status/1840854149639848011


6,786 posted on 09/30/2024 3:39:36 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6785 | View Replies]

To: PIF; All

Who will be the loser? You know who.

“Kazakhstan Seeks to Boost China Gas Exports With Possible New Pipe”

“Kazakhstan is in talks with China about increasing gas exports and is even considering building an additional pipeline to boost flows, underscoring the growing significance of its role in the region’s fuel market.

Kazakhstan will be competing with neighboring countries including Turkmenistan and Russia for Chinese demand. Moscow’s invasion of Ukraine nearly three years ago led to it cutting off major buyers in Europe, with China becoming a key alternative market even amid sputtering economic momentum.”

[PAYWALL] https://www.bloomberg.com/news/articles/2024-09-30/kazakhstan-seeks-to-boost-china-gas-exports-with-possible-new-pipe?srnd=homepage-americas


6,787 posted on 09/30/2024 6:31:35 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6786 | View Replies]

To: PIF; All

Sounds like Clinton has some inside knowledge of Willie Brown’s mistress ‘events’. Coming to an online discussion near you...

“Former Secretary of State Hillary Clinton warned of an October surprise that will “distort and pervert” Vice President Harris.

“There will be concerted efforts to distort and pervert Kamala Harris, who she is, what she stands for, what she’s done,” Clinton said during an interview with “Firing Line” host Margaret Hoover.”


6,788 posted on 09/30/2024 6:34:38 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6787 | View Replies]

To: PIF; All

“China’s Housing Glut Collides With Its Shrinking Population”

“Many cities are stuck with empty homes that they will likely never fill, adding to the country’s economic woes”

“China’s real-estate bust left behind tens of millions of empty housing units. Now that historic glut of unoccupied property is colliding with China’s shrinking population, leaving cities stuck with homes they might never be able to fill.

The country could have as many as 90 million empty housing units, according to a tally of economists’ estimates. Assuming three people per household, that’s enough for the entire population of Brazil.

Filling those homes would be hard enough even if China’s population were growing, but it’s not. Because of the country’s one-child policy, it is expected to fall by 204 million people over the next 30 years.

“Fundamentally, there are not enough people to fill the homes,” said Tianlei Huang, a research fellow at the Peterson Institute for International Economics.

Some unused real estate will be bought up and lived in, especially if more government support—which economists have been calling for—convinces Chinese buyers that values will rise again. Big cities like Beijing, Shanghai and Shenzhen will almost certainly absorb their excess housing, given their dynamic economies and migrant inflows, which have helped keep their populations growing.”

[PAYWALL] https://www.wsj.com/world/china/china-housing-glut-population-economy-09cffa6a?mod=hp_lead_pos7


6,789 posted on 09/30/2024 7:17:56 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6788 | View Replies]

To: SpeedyInTexas

“Kazakhstan is in talks with China about increasing gas exports and is even considering building an additional pipeline.”

Power of Siberia 2 is so dead. Putin did that.

Putin has firmly impressed on everyone, including China, that Russia is not a reliable source for essential energy. China knows it is better off with providers who will not (can not afford to) cut them off, if politics sour at some point.

A Kazakh pipeline would also be cheaper to build, than Power of Siberia 2.


6,790 posted on 10/01/2024 2:20:48 AM PDT by BeauBo (E)
[ Post Reply | Private Reply | To 6787 | View Replies]

To: PIF; All

“White House believes Iran is preparing imminent ballistic missile attack against Israel”

“A senior White House official says the US believes Iran is preparing to “imminently launch a ballistic missile attack against Israel.”

“The United States has indications that Iran is preparing to imminently launch a ballistic missile attack against Israel,” a full statement reads.

“We are actively supporting defensive preparations to defend Israel against this attack. A direct military attack from Iran against Israel will carry severe consequences for Iran,” it continued.”


6,791 posted on 10/01/2024 6:53:57 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6790 | View Replies]

To: PIF; All

“The Lies Russia Tells Itself”

“The Country’s Propagandists Target the West—but Mislead the Kremlin, Too”

“In early September, the infamous Russian disinformation project known as Doppelganger hit the news again.
Doppelganger—a scheme to disseminate fake articles, videos, and polls about polarizing political and cultural issues in the United States, as well as in France, Germany, and Ukraine—was first exposed in 2022 and widely covered in the Western press. The project cloned entire news organizations’ websites—complete with logos and the bylines of actual journalists—and planted its own fake stories, memes, and cartoons, luring casual Internet users to the sites via social media posts, often automated ones.

Tech companies and research labs had carefully traced, documented, and often removed some of Doppelganger’s online footprints, and even exposed the private Moscow firm mostly responsible for the campaigns: the Social Design Agency. But the disinformation campaigns persisted, and on September 4, in a move to counter them, the U.S. Department of Justice announced that it had seized 32 Internet domains behind the Doppelganger campaign—and published an unprecedented 277-page FBI affidavit that included 190 pages of internal SDA documents likely sourced by American spies. Then, 12 days later, the German daily Süddeutsche Zeitung reported that, in late August, it had received from an anonymous source, large amounts of authentic internal SDA documents. A day before the FBI released its affidavit and the accompanying files—some of which overlapped with the leaked ones—Süddeutsche Zeitung asked me to comment on the leak for its investigation, because I have researched and written about disinformation and political warfare for almost ten years. I inquired whether its source might allow me to have the entire 2.4 gigabytes of leaked SDA documents, and the source agreed.

Until these recent disclosures—comprising more than 3,000 individual files—observers could mostly just speculate about the goals, specific methods and tradecraft, and bureaucratic procedures driving contemporary Russian disinformation campaigns. The FBI affidavit and the European media leak offered something unprecedented: a glimpse into the planning of one of the most notorious disinformation efforts in the post–Cold War era. Disinformation operators taking advantage of the Internet to disseminate propaganda to gullible users had been a major concern since at least 2015, when the efforts of a St. Petersburg troll factory known as the Internet Research Agency to inflame latent conflicts was exposed in the press, and Russian military intelligence deployed creative disinformation operations to interfere in the 2016 U.S. presidential race.”

///////////

“The SDA’s top goal was not to influence citizens in adversary countries, but to persuade Russian bureaucrats that the company was effective in order to get the next contract or renew a budget. “

https://www.foreignaffairs.com/russia/lies-russia-tells-itself


6,792 posted on 10/01/2024 7:07:32 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6791 | View Replies]

To: PIF; All

“Destruction of a Russian Grad BM-21 MLRS, reportedly in the Zaporizhzia region.”

https://x.com/NOELreports/status/1841098679924502844


6,793 posted on 10/01/2024 7:10:39 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6792 | View Replies]

To: SpeedyInTexas

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Russians Lose 55 Tanks & BMPs, 1,000 men in 20 Minutes ]


Today [ Oct 01 ], there are a lot of updates from the Kupiansk direction.

Here, Russian forces launched their largest mechanized assault in months, hoping to break through Ukrainian defenses in order to reach the Oskil River and the city of Kupiansk & to storm it after that. Ukrainian troops responsible for holding the frontline in this area were put under pressure by 2 massive columns with over 60 tanks and armored vehicles, but were ready to deal another deadly blow to the enemy.

Russian forces have created a small tactical salient around Pishchane in recent weeks and have focused on advancing as quickly as possible. They moved along a ravine running east of Pishchane and in the fields south and north of the settlement, but have struggled so far to advance in the fields immediately east of Kolisnykivka and Kruhlyakivka.

The command of the Russian Western Grouping of Forces has decided to organize a large mechanized assault to advance rapidly through these open territories, consolidating positions within Kolisnykivka and Kruhlyakivka, enabling Russian infantry to establish a more enduring foothold within the 2 settlements on the Oskil River.

Soon, Ukrainian drone operators conducting reconnaissance in the area reported a large gathering of enemy forces in the vicinity of Pishchane, a roughly battalion-sized Russian mechanized assault group consisting of more than 60 tanks and armored vehicles, making it the largest such assault in the Kupyansk-Svatove-Kreminna line, since last winter.

This group split into 2 columns - 1 with around 40 armored vehicles moving in the direction of Kolisnykivka and 1 with around 20 heading towards Kruhlyakivka.

The 1st column was intercepted by drone operators of the Ukrainian 77th Airmobile Brigade, and soon, they posted geolocated footage showing more than a dozen damaged and destroyed Russian armored vehicles crowded close to one another, suggesting that they attacked in a tight column, and became jammed once the leading vehicles were successfully hit by FPV drones.

This common occurrence in failed Russian mechanized assaults not only blocks the movement forward, but spreads panic among the Russian crews, which leads to chaos on the battlefield, making survival of equipment and personnel even harder.

The released footage continues with Russian vehicles attempting to turn back and run away from the battlefield, but to no avail as Ukrainian drone operators continued their hunt, trying to not let anyone get away.

The brigade command reported that during this operation, they have destroyed 3 tanks and 11 other armored vehicles, and have damaged 10 tanks and 16 armored vehicles, which means that the deadly Ukrainian response has not left a single Russian piece of equipment from the 40 attacking, without harm.

The 2nd Russian column consisting of 20 armored vehicles, aimed at reaching Kruhlyakivka, but was also spotted early enough so the operators of the Achilles drone strike battalion from the Ukrainian 92nd Assault Brigade launched a swarm of kamikaze drones to stop the enemy, before even crossing the fields.

The extensive footage shows not only the expert work of the Ukrainian troops, but also the wide range of vehicles the Russians used for this operation: from a turtle tank and regular tanks to different infantry fighting vehicles, various supply vehicles, and even ATVs.

Russians were trying to prevent their vehicles from getting destroyed by using mobile electronic warfare systems and smoke screens, but unfortunately for them that was not enough to stop the dozens of Ukrainian drones dominating the sky.

Surviving crew members of the Russian assault group were also immediately targeted with grenades dropped by drones, and soon the Ukrainian commanders reported that they had reached almost 100% destruction ratio again, with all enemy vehicles being damaged or destroyed during the operation.

Overall, Ukrainians understand very well the importance of keeping the Russians at least 10 kilometers away from Kupiansk, and that’s why they have deployed here some of their best brigades with soldiers staying on high alert day and night, anticipating every Russian move.

These defensive precautions helped them repel back the biggest mechanized assault so far this year in the direction of Kupiansk. Russian forces lost more than 60 armored vehicles in a single attack, and are now back at their starting positions near Pishchane, which prompted criticism from Russian military analysts that this army group has consistently failed all offensive operations in this region, and with not been able to advance now before the anticipated change in the weather, they will most likely be pressured to take a long operational break.


6,794 posted on 10/01/2024 8:18:20 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6793 | View Replies]

Russian Offensive Campaign Assessment, September 30, 2024

Russian President Vladimir [11] Putin signed a decree on September 30 updating the membership of the Russian Security Council — a key Russian consultative body that informs Putin's decisions on national security issues. [12] Putin removed First Deputy Speaker of the Russian Federal Council Vladimir Yakushev from the Russian Security Council after removing Yakushev from his role as the Kremlin Representative to the Urals Federal District on September 24.[13] Dyumin is the youngest ever member of the Russian Security Council at 52 years old and has been a loyal supporter of Putin's regime since he served as Putin's bodyguard beginning in 1999.[14] The Russian Security Council is mostly composed of officials of Putin's generation (with most born in the 1950s), and Dyumin’s appointment suggests that Putin is preparing a new generation of officials.[15] Putin has been steadily promoting Dyumin since the Wagner Group armed rebellion in June 2023, with Dyumin becoming the presidential aide for the defense industrial base (DIB) and secretary of the advisory State Council in May 2024.[16] Putin later tasked Dyumin with supervising the Russian response to Ukraine's incursion into Kursk Oblast in August 2024.[17] Putin also recently promoted Manturov (who is 55 years old) to the position of first deputy prime minister in May 2024, despite previously using Manturov as a scapegoat for Russian DIB problems and the inadequate response to Ukraine's incursion into Kursk Oblast.[18] Skvortsova (63 years old) previously served as the Russian Minister of Health between 2012 and 2020 before becoming the head of FMBA, and Putin recently reappointed Skvortsova to the position of FMBA head in late June 2024.[19] Linets (61 years old) previously served as the deputy chief of the Russian Federal Security Service (FSB) of the 20th Combined Arms Army and as head of FSB Directorate for the Southern Military District (SMD) before assuming his current role in 2015.[20] Linets has also served as a member of the Russian Military-Industrial Commission since 2015.

Russian Prime Minister Mikhail Mishustin arrived in Tehran on September 30 to meet with various Iranian officials and highlight Russo–Iranian economic cooperation.[29] Mishustin met Iranian President Masoud Pezeshkian and stated that he expects that Russia and Iran will sign the anticipated comprehensive strategic cooperation agreement at the upcoming BRICS summit in Kazan, Republic of Tatarstan, from October 22 to 24.[30] Mishustin also met with Iran's First Vice President Mohammad Reza Aref to talk about opportunities for Russian investment in “various fields” in Iran and notably met with Iranian Oil Minister Mohsen Paknejad.[31] Iranian Ambassador to Russia Kazem Jalali reported that Mishustin’s visit to Iran will particularly focus on developing trade and economic ties between the two countries.[32] Russian and Iranian officials likely view expanded economic and financial cooperation as a necessary component of generally intensified Russo–Iranian relations.

more + maps https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-september-30-2024

6,795 posted on 10/01/2024 9:18:12 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6759 | View Replies]


6,796 posted on 10/01/2024 9:20:03 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6760 | View Replies]


6,797 posted on 10/01/2024 9:22:04 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6761 | View Replies]

To: AdmSmith

Kyiv Independent:

“Joe Biden may agree to advance the status of Ukraine’s NATO membership bid before leaving office in January, the Financial Times (FT) reported on Oct. 1, citing an unnamed Western official.”


6,798 posted on 10/01/2024 10:26:13 AM PDT by BeauBo
[ Post Reply | Private Reply | To 6797 | View Replies]

To: SpeedyInTexas

The new NATO Secretary General takes office today.

Kyiv Independent reports:

“NATO has to ensure that Ukraine “prevails as a sovereign, independent, democratic nation,” Mark Rutte said on Oct. 1, as he took the helm as the new secretary general of the military alliance.

Speaking alongside the outgoing Jens Stoltenberg during a press conference at NATO headquarters in Brussels, Rutte praised his predecessor’s achievements during his tenure.

“You’ve already mentioned the priorities you’ve been working on and these priorities we’ll take forward in the future — Ukraine,” he said.

“We have to make sure that Ukraine prevails as a sovereign, independent, democratic nation.”

Rutte added that NATO members have to “spend more” in order to “increase our collective defense,” adding: “NATO’s partnerships… have to go wider, and deeper, given all the insecurities in the world.”

Answering questions from reporters, Rutte also addressed the upcoming U.S. presidential election, diplomatically addressing both Kamala Harris and Donald Trump.

“I know both candidates very well. I worked for four years with Donald Trump. He was pushing us to spend more, and he achieved it — at the moment we are at a much higher spending level,” he said, adding: “He was also pushing us off China, and he was right.

“Of course, Kamala Harris has a fantastic record as vice president, she is a highly respected figure. So, I hope, I will be able to work with both.””


6,799 posted on 10/01/2024 10:31:52 AM PDT by BeauBo
[ Post Reply | Private Reply | To 1 | View Replies]

To: BeauBo

OSINTdefender@sentdefender

The Israel Defense Force states that the Air Force will carry out “Powerful Airstrikes” tonight, throughout the Middle East.

Sorry no link posted


6,800 posted on 10/01/2024 12:20:55 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6799 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 6,761-6,7806,781-6,8006,801-6,820 ... 19,201-19,219 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson