Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 6,541-6,5606,561-6,5806,581-6,600 ... 21,381-21,391 next last
To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Russian Remnants Are Withdrawing From Vovchansk ]


Today [ Sept 23 ], there are a lot of updates from the Kharkiv direction.

Here, the Ukrainians changed the tide of the battle of Vovchansk after successfully retaking control of powerful Russian positions at the local aggregate plant, some of the most important positions in the entire city. This development has led to the gradual collapse of defenses and logistical support, putting Russian forces at serious risk of being pushed out of Vovchansk completely.

After nearly five months of intense fighting, Vovchansk has become one of the most heavily destroyed cities in Ukraine, with the majority of the destruction concentrated in its northern part. This extensive devastation is significant for the ongoing battle, as it prevents Russian troops from concealing and accumulating their forces in the area.

Northern Vovchansk has two key strongholds: the high-rise Citadel and the aggregate plant. The Citadel was severely damaged, leaving most of it in ruins and unsuitable for troop positioning by either Russians or Ukrainians.

Additionally, many surrounding smaller residential buildings have been destroyed or are no longer viable for use by troops.

As a result, the only fortified stronghold left in northern Vovchansk was the aggregate plant. Its buildings remained standing due to their strong construction. Though the area was under Russian control, the plant’s status as one of the few usable fortifications made it easy for Ukrainian forces to pinpoint Russian troop concentrations. This led to prolonged Ukrainian airstrikes and artillery shelling, which intensified as the Russian forces at the plant became fully encircled and cut off from nearly all support.

The Ukrainian command chose not to assault the plant directly, but instead aimed to starve the Russian garrison of ammunition and food, while continuously striking their positions to maximize losses. This dire situation forced the Russian fighters to scavenge for food, medical aid, and water, as they had no other supply options.

Additionally, Russian troops outside the plant attempted to deliver supplies using drones, which was the only reason the besieged forces managed to hold out for so long.

This enabled the Ukrainians to capitalize on the collapse of the Russian defense of the plant, and finally take it after the Russian defenses and troops holding out there were destroyed, after months of intense bombing and shelling. With the plant under the control of the Ukrainian forces, they could now regain the initiative in the Vovchansk area.

Since the Vovchansk aggregate plant is the only remaining complex of high-rise buildings in the town, the Ukrainians can establish effective fire control over northern Vovchansk. With control of these high-rises, Ukrainian forces can monitor all Russian movements in the area, allowing them to relay precise location data to artillery, aviation, and drone operators for rapid strikes.

As a result, Russian positions north of the aggregate plant and east of the now-destroyed Citadel became completely untenable, due to Ukrainian fire control from the plant. This fire control enabled Ukrainian forces to intensify their counterattacks, swiftly pushing the Russians back several streets from the south and east of the salient.

With positions inside Vovchansk nearly untenable for Russian forces, the Russian command has been forced to keep the bulk of their troops in the forests north of the city, leaving only a smaller contingent in the town.

While these forces are less exposed to Ukrainian fire outside the city, the falling autumn leaves are reducing their cover, making it easier for Ukrainians to deploy thermite drones against their positions.

Combat footage shows Russian troops being quickly targeted by Ukrainian artillery in the forests soon after detection, dispersing them and preventing further squad-sized assaults in Vovchansk.

Overall, the Ukrainians managed to successfully retake the only remaining standing stronghold in Vovchansk after a prolonged siege, and effectively force the Russian troops to withdraw the majority of their forces outside the city.

With control of the aggregate plant, Ukrainians can effectively detect and destroy any Russian movements within the town, preventing Russian advances in the area. At the same time, securing the plant allowed the Ukrainians to regain momentum, launching successful counterattacks that significantly reduced the Russian bridgehead.


6,561 posted on 09/23/2024 4:21:13 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6560 | View Replies]

Russian Offensive Campaign Assessment, September 22, 2024

Russia is reportedly expanding intelligence operations in Mexico to undermine the United States and support for Ukraine. NBC News, citing unspecified US officials and former intelligence officers, reported on September 21 that Russian intelligence services have been increasing their presence in Mexico for the past few years in order to spy on the United States and to enhance propaganda meant to undermine the United States and Ukraine.[23] US officials reportedly expressed concern over Russia's addition of dozens of employees to its embassy staff in Mexico City, despite notably lacking strong trade relations with Mexico, and interpreted this growth as a return to Cold War-style tactics to enhance intelligence operations in Mexico. CIA Director Willian Burns recently noted that this increase is a result of the expulsion of Russian spies from Europe.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-september-22-2024

6,562 posted on 09/23/2024 5:05:19 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6528 | View Replies]


6,563 posted on 09/23/2024 5:08:30 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6529 | View Replies]


6,564 posted on 09/23/2024 5:09:56 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6531 | View Replies]

To: SpeedyInTexas; PIF; marcusmaximus; gleeaikin; BeauBo; FtrPilot
Russian blogger:

Why the Sarmat missile exploded right in the silo. Three reasons named

An emergency occurred during a test launch of the RS-28 Sarmat ICBM at the Plesetsk test site in the Arkhangelsk region. The missile failed to take off and exploded inside the silo. Sources particularly emphasized that the missile was not equipped with a nuclear warhead. Apparently, the order to disseminate this information was given by the Ministry of Defense. Based on conversations with our sources in the defense department, we received three versions of what happened .

They were in a hurry with this test launch. They say the generals wanted to make one launch at the end of September, and the next one at the beginning of October - for Vladimir Vladimirovich's birthday,” says a high-ranking source.

But haste is only the first reason for the failure of the tests. The second is even more prosaic - theft. A source in the Ministry of Defense notes that “colossal funds were allocated” for the creation and testing of the Sarmat. An interlocutor involved in the arms trade process does not hide his surprise at the failure of the Sarmat story. “We don't need the missile right now. But the blow to the image of Russian weapons is incredible. It's amazing how much money they managed to steal, I think no one will know. Now they will start checking and new arrests will begin ,” the source said.

The third reason is not so obvious, but our sources in the Ministry of Defense hint that the problems could have arisen because of the technological elements of the missile. “Some unique chips are really hard for us to get because of the sanctions. There won't be many details, but there are rumors that some of the boards were replaced with domestic ones - and this is the result,” the interlocutor said.

Be that as it may, due to the activities of high-ranking officials, a serious incident occurred today that threatens not only the production of the Sarmat, but also the further export of our weapons abroad.

https://t.me/kremlin_secrets/4684

https://en.wikipedia.org/wiki/RS-28_Sarmat

6,565 posted on 09/23/2024 5:22:21 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6526 | View Replies]

To: PIF; All

Iran backing down?

“Iran’s President Says He’s Prepared to Ease Tensions With Israel”

“Pezeshkian urges each nation ‘to put all our weapons aside’”

“President set to make first appearance at UN General Assembly”

“Iran is prepared to de-escalate tensions with Israel as long as it sees the same level of commitment on the other side, President Masoud Pezeshkian said.

“We’re willing to put all our weapons aside so long as Israel is willing to do the same,” Pezeshkian told reporters Monday ahead of the UN General Assembly in New York. “We’re not seeking to destabilize the region.”

Pezeshkian is in the US for his first appearance at the UN’s annual gathering, where he’s scheduled to speak on Tuesday. Israeli Prime Minister Benjamin Netanyahu is expected to address the same summit two days later, though his travel itinerary hasn’t been finalized.”

https://www.bloomberg.com/news/articles/2024-09-23/iran-s-president-says-he-s-prepared-to-ease-tensions-with-israel?srnd=homepage-americas


6,566 posted on 09/23/2024 9:06:16 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6565 | View Replies]

To: PIF; All

“Russia Sees Oil and Gas Revenue Shrinking for Next Three Years”

“Lower energy prices, tax changes will crimp state budget”

“Revenue seen falling 14% from 2024- 2027 in draft projections”

“The Russian government sees its oil and gas revenue falling for the next three years due to lower energy prices and a more lenient tax regime for Gazprom PJSC.

According to a draft three-year budget seen by Bloomberg News, this key source of funds for the Kremlin will slide by 14% from 2024 to 2027, with implications for the war in Ukraine and Moscow’s escalating military spending.

Russia’s oil and gas industry is set to contribute 10.94 trillion rubles ($118 billion) in taxes to state coffers next year, according to the draft projections prepared by the government. That would be 3.3% less than the projection for 2024. Annual revenue is expected to keep declining in the following two years, reaching 9.77 trillion rubles in 2027, the documents show.”

https://www.bloomberg.com/news/articles/2024-09-23/russia-sees-oil-and-gas-revenue-shrinking-for-next-three-years?srnd=homepage-americas


6,567 posted on 09/23/2024 11:06:34 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6566 | View Replies]

To: PIF; All

‘no sign of ending’ - No Peace talks until Kursk is ‘liberated’. Sounds like a plan.

“Russia Keeps the Money Rolling in for Putin’s War in Ukraine”

“Draft budget shows defense spending at 6.2% of GDP next year”

“Government sees only small fall in 2026, 2027 defense budgets”

“Russia plans to maintain defense spending at an historic high in 2025 and sees only slight declines in the following two years as President Vladimir Putin’s war on Ukraine shows no sign of ending.

Draft three-year budget proposals seen by Bloomberg News show the government intends to increase defense spending to 13.2 trillion rubles ($142 billion) in 2025 from 10.4 trillion rubles projected for this year, putting it at 6.2% of gross domestic product. Military expenditure is planned to decline to 5.6% of GDP in 2026 and 5.1% in 2027, according to Bloomberg calculations based on the draft data.”

https://www.bloomberg.com/news/articles/2024-09-23/russia-budget-plans-show-no-let-up-in-putin-s-war-on-ukraine?srnd=homepage-americas


6,568 posted on 09/23/2024 11:10:16 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6567 | View Replies]

To: AdmSmith

Reminds me of another similarity to Nazi German by the Russians

Specifically showing hitler the type XXI for his 55th birthday, it was kept afloat by float bags, all to impress Dear leader

Cult of personality…..


6,569 posted on 09/23/2024 5:13:36 PM PDT by blitz128
[ Post Reply | Private Reply | To 6565 | View Replies]

To: PIF; All

BRICS, RICKS, DICKS

“Top Economist in China Vanishes After Private WeChat Comments”

“Government adviser is detained as Xi Jinping targets negative comments about Chinese economy”

“A prominent economist at one of China’s top think tanks was placed under investigation, detained and removed from his posts after he allegedly criticized leader Xi Jinping’s management of the world’s second-largest economy in a private chat group, according to people familiar with the matter.

The investigation of Zhu Hengpeng, who for the past decade was deputy director of the Institute of Economics at the state-run Chinese Academy of Social Sciences, comes as the Communist Party ramps up efforts to suppress negative commentary about China’s economic health.

Beijing has struggled to revitalize a sluggish economy weighed down by a real estate slump and tepid sentiment among consumers and businesses—weaknesses that, some economists say, have been exacerbated by Xi’s efforts to boost the state sector, rein in what he considers capitalistic excess, and protect China against perceived foreign threats.

Under Xi, the party has directed a far-reaching clampdown on dissent that has punished critics of his leadership inside the party and beyond, with some high-profile targets, including influential business people and academics, getting detained, imprisoned or forced into exile. Authorities have also tightened controls on data, curtailing access to information prized by investors and analysts for insights into China’s economy. “

https://www.wsj.com/world/china/top-economist-in-china-vanishes-after-private-wechat-comments-50dac0b1?mod=hp_lead_pos5


6,570 posted on 09/23/2024 9:37:19 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6569 | View Replies]

To: blitz128

The personality cult of Putin: How Vladimir uses assassinations and bare-chested photo ops to rule unchallenged... and has laid the foundations for CIVIL WAR or another deadly dictator to step up when he dies
Putin has led Russia as President or Prime Minister for almost a quarter-century
The Kremlin chief spent two decades crafting a coup-proof cult of personality
But one vital question remains: just what is going to happen when he’s gone?

https://www.dailymail.co.uk/news/article-13191773/Personality-cult-Putin-Vladimir-assassinations-bare-chested-CIVIL-WAR-deadly-dictator.html


6,571 posted on 09/24/2024 12:43:25 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6569 | View Replies]

To: SpeedyInTexas
Not only Zhu Hengpeng is purged:

The Chinese Academy of Social Sciences (CASS) has reportedly experienced a “political earthquake” in its Institute of Economics. The entire leadership was replaced due to allegations of “inappropriate discussions about the central government.” The event was triggered by the alleged misconduct of Deputy Director Zhu Hengpeng, leading to a complete overhaul of the institute's leadership. Zhu, 55, was also the director of CASS’s Public Policy Research Center, focusing on public hospital reforms and medical security systems.

By the end of last month, the institute's director, party secretary, and deputy directors were all replaced. The CASS Party Committee appointed new leadership, including Gong Yun as party secretary, Li Xuesong as director and deputy party secretary, and Song Hong as deputy director.

http://chinascope.org/archives/35936

China's economy will crash.

6,572 posted on 09/24/2024 12:50:42 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6570 | View Replies]

Russian Offensive Campaign Assessment, September 23, 2024

A high-ranking Russian Aerospace Forces (VKS) commander reportedly recently committed suicide due to conflicts within his unit’s leadership. A Russian insider source claimed on September 23 that Yuri Annekov, head of the 678th Communications Center of the Russian Aerospace Forces (VKS), committed suicide at the end of last week in Balashikha, Moscow Oblast.[15] The insider source claimed that Annekov had recently complained about insufficient rest and the command’s “inadequate” behavior. The insider source claimed that Annekov had served in the VKS for roughly 20 years and had tried to resist the “chaos and disorder” within the VKS that began after Russia’s full-scale invasion of Ukraine. ISW cannot verify the insider source’s claims.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-september-23-2024


6,573 posted on 09/24/2024 12:52:52 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6562 | View Replies]


6,574 posted on 09/24/2024 2:24:45 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6564 | View Replies]

To: AdmSmith

Numbers in all categories are up, someone’s birthday must be approaching


6,575 posted on 09/24/2024 4:38:54 AM PDT by blitz128
[ Post Reply | Private Reply | To 6574 | View Replies]

To: AdmSmith

It is fascinating to see all these outside predictions for the Russian and Chinese economies. Even before the “data” from these countries were given and now withheld I can only imagine even then they were not accurate.

I realize there is some back engineering people can do to try and find out some information, but even then how accurate of a picture can it be.

To me the most telling is the amount of data they used to provide (true or not), and how little they do now


6,576 posted on 09/24/2024 4:43:40 AM PDT by blitz128
[ Post Reply | Private Reply | To 6572 | View Replies]

To: SpeedyInTexas

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Russians in Shock! 6 Months Worth of Ammo Wiped Out! ]


Today [ Sept 24 ], there are a lot of updates from the Russian Federation.

Here, in the last couple of days, Ukrainian forces launched a devastating series of strikes, destroying not only recently arrived military supplies from North Korea and Iran but also Russia’s strategic stockpiles of weaponry.

Despite still lacking permission from Western allies to use long-range missiles deep within Russian territory, Ukraine has effectively used their newest game-changer drones Palianytsia to deliver a significant blow to Russian offensive capabilities.

First of all, Ukrainian forces wiped out two Russian strategic missile and ammunition storage depots in the Tver region.

The first target was a Russian storage facility near Toropets. To breach Russian air defenses and ensure the strike’s success, Ukrainian forces deployed over 100 drones.

A source within Ukrainian special services revealed that the operation initially hit the Russian Ministry of Defense’s 107th Arsenal, which housed Iskander and Tochka-U ballistic missiles, anti-aircraft missiles, artillery ammunition, and recently delivered North Korean KN-23 ballistic missiles.

Geolocated footage from the strike showed massive secondary explosions, likely from missile stockpiles and artillery munitions, following the initial drone impact. Later satellite imagery confirmed extensive damage to the facility’s structures.

Although Russian authorities tried to downplay the attack, claiming there was no direct hit and that debris from a downed Ukrainian drone caused the detonations, they were forced to temporarily evacuate the surrounding area.

Russian military bloggers heavily criticized local officials for the poor construction of the base, highlighting corruption trials involving high-ranking officers, and speculated that improper handling of missiles and ammunition may have contributed to the scale of the explosions.

But this was just the beginning. The second strike in this region occurred at the 23rd Arsenal near Oktyabrsky, just 20km south of Toropets and the available satellite images show that a substantial portion of the arsenal was destroyed due to the Ukrainian drone attack. According to military analysts, these 2 operations alone reportedly destroyed enough munitions to affect the Russian offensive in Ukraine in the coming months.

Estonian Defense Forces Intelligence chief Colonel Ants Kiviselg, stated that the attack caused over 30,000 tons of munitions to explode, noting that the size of the explosion equates to more than 750,000 artillery shells. His calculations suggest the Ukrainian strike destroyed equivalent to almost three months of Russia’s ammunition supply.

The 3rd target became the Russian Tikhoretsk Arsenal, located in the Krasnodar region. In order to ensure that the drones could reach the target, Ukrainians first destroyed a Russian Podlet K1 mobile long-range radar system as it was protecting the Russian strategic ammunition depot.

This system can follow up to 200 aerial targets simultaneously at a range of up to 300km and is used to detect air targets at low altitudes for Russian air systems. Given that Ukrainians use swarms of drones flying exactly at such altitudes to attack targets deep into Russian territory, this attack was a preparation for what was about to follow.

Once the radar system was neutralized, Ukraine launched a massive follow-up drone assault on the large missile and ammunition storage facility. The Ukrainian General Staff reported that drone operators successfully struck the Tikhoretsk Arsenal, with geolocated footage capturing a series of explosions and secondary detonations, as fires continued to burn for the next 24 hours. Ukrainian officials confirmed the destruction of several thousand tons of munitions, including stockpiles recently supplied by North Korea.

Ukrainian armed forces also recently targeted several smaller ammunition depots around Mariupol. Local citizens released footage of the explosions and what was supposed to be the work of Russian air defense units. Hours later satellite images confirmed the damage to various facilities and showed the scale of the fire after these successful attacks.

In a a bizarre repeat of previous denials, the Russian Ministry of Defense again claimed that no direct hits occurred, attributing all damage to fallen Ukrainian drone debris.

However, widely available satellite imagery, combined with the declaration of states of emergency, altered railway schedules, rerouted trains, and the mass evacuation of thousands of civilians from the affected areas, makes these claims appear hollow.

This is especially evident, considering that these facilities had reportedly undergone recent modernizations after years of improperly storing munitions, further undermining the credibility of Russia’s response.

Overall, Ukraine’s ongoing strikes on Russian logistics facilities are exerting significant pressure on the Russian military, extending far beyond the immediate loss of ammunition stock piles. These precision attacks are diminishing Russia’s ability to carry out long range missile strikes on Ukraine, much like the impact of the HIMARS strikes in the summer of 2022.

The Institute For The Study of War suggests that these Ukrainian operations will likely Force Russia to reorganize and disperse its logistics networks to minimize further damage. Despite the protection offered by restrictions on Ukraine’s use of Western supplied weapons, Russian vulnerabilities remain and not all logistic sites are beyond Ukraine’s reach.

As restrictions are expected to ease and Ukraine’s long range strike capabilities advance, the country is increasingly positioned to exploit these weaknesses.

Within the 750 km range of the Palianytsia drone, for instance, 6 key Russian arsenals, including those in Toropets, store thousands of tons of ammunition, making them prime targets for future Ukrainian strikes.


6,577 posted on 09/24/2024 5:10:16 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6570 | View Replies]

To: PIF

Satellite Images Show Massive Devastation At Russian Ammo Storage Sites Struck By Ukrainian Drones
Before and after satellite images of the Oktyabrsk, Tikhoretsk and Toropets munitions storage facilities show the recent results of Ukraine’s long-range drone operations.
https://www.twz.com/news-features/satellite-images-show-massive-devastation-at-russian-ammo-storage-sites-struck-by-ukrainian-drones


6,578 posted on 09/24/2024 5:11:03 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6577 | View Replies]

To: PIF

6,579 posted on 09/24/2024 5:12:24 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6578 | View Replies]

To: PIF
Some more pretty pictures:

Usually, it takes me some time to assess the damage of base like that after an Ukrainian strike, but this is quite easy:

The Tikhoretsk ammunition site is completely destroyed. Every single building and ammo dump is completely wiped out. Even the trains and cars are destroyed. The level of destruction can only be described as complete. This is ground zero. Period.

https://x.com/Tendar/status/1838307312647479633


6,580 posted on 09/24/2024 6:14:50 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 6579 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 6,541-6,5606,561-6,5806,581-6,600 ... 21,381-21,391 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson