Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 6,321-6,3406,341-6,3606,361-6,380 ... 20,981-21,000 next last
To: PIF; All

“The Ukrainian Armed Forces have received 18 2S22 Bohdana self-propelled artillery units funded by Denmark, which were manufactured in just two months. Danish Defense Minister Poulsem noted that producing weapons in Ukraine is much cheaper than in the West and also more cost-effective to maintain. He urged more European countries to finance weapon production in Ukraine. The 2S22 Bohdana is a Ukrainian self-propelled artillery system with a 155mm caliber gun, compatible with NATO standards.”

https://x.com/NOELreports/status/1835044852951924968


6,341 posted on 09/15/2024 6:19:41 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6340 | View Replies]

To: PIF; All

“What remains of the Russian Black Sea Fleet has sailed from Novorossiysk under the pretext of Ocean-2024 naval exercises. Russians have removed their aircraft, as well. Also naval exercises?

Meanwhile, OSINT researchers attribute this withdrawal to relocating them from within the range of ATACMS missiles.

At the end of 2023, the Black Sea Fleet ships from Sevastopol were redeployed to Novorossiysk after the Ukrainian strikes.

The withdrawal of the ships from the Novorossiysk port was captured by a satellite image taken on Saturday at 11:37 a.m. local time.
@CovertShores
believes that Russia fears that Kyiv will be authorised to use Storm Shadow missiles.

It is not known where exactly the ships were sent. But since 2023, Russia has been building a naval base in Abkhazia, and since the beginning of 2024, as reported by Bellingcat, the work has accelerated.

Aircraft are also being moved out of the likely area of impact of Western missiles. Satellite imagery shows that aircraft are being relocated from airfields that are in the target zone of ATACMS missiles, writes Radio Liberty journalist Mark Krutov. He drew his conclusions by analysing images from this and last year.

Russian aviation began to leave airfields located near the border in the second half of June, according to analysts of the OSINT project Frontelligence Insight. The relocated equipment includes aircraft and attack helicopters.”

https://x.com/Gerashchenko_en/status/1835243892783878648


6,342 posted on 09/15/2024 6:22:41 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6341 | View Replies]

To: AdmSmith

I am sure that is going on, but I also imagine part
Of it is just a lack of personnel for the meat waves

It occurred to me that at least one of Russian benefit to their slow roll is that their lines and logistics are not stretched even more

Imagine a situation where they had an additional 50-100 kilometers to get supplies.

One of the reasons for the stall in German advances in WW2 towards the east was the vast distance to move supplies and the general lack of good logistic lines
Even the Allie’s suffered that during invasion of France. They couldn’t move fuel fast enough, and had to pause to let logistics catch up


6,343 posted on 09/15/2024 6:27:01 AM PDT by blitz128
[ Post Reply | Private Reply | To 6320 | View Replies]

To: SpeedyInTexas

Kremlin snuff box, 09/15/24
https://t.me/s/kremlin_secrets

War with NATO will not happen this year

A high-ranking source in the General Staff told us about this. “If we talk about a direct and major war with NATO, then this year it is impossible. The next one is hard to say. There are still many problems that prevent us from preparing well,” the military man noted.

At the same time, he refused to comment on our promises to respond to NATO countries for allowing the Kiev regime to fire long-range weapons deep into Russian territory. Including statements by Dmitry Medvedev regarding, among other things, the use of nuclear weapons.

“These are all statements by politicians. And it’s not my place to comment on them. I am telling you as a military man. I speak frankly because you are honest people and they trust you. And the Russians, I think, deserve to know the truth,” the source explained.

He also admitted that the fighting in the Kursk region began to drag on again. And he refused to comment on the information that the ships of the Black Sea Fleet were withdrawn from the port of Novorossiysk due to fears that they would be attacked by Western missiles. We are still looking into this issue and will inform you when we find out the details.


6,344 posted on 09/15/2024 7:17:38 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6342 | View Replies]

To: blitz128

Very informative interview.


6,345 posted on 09/15/2024 7:42:41 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6334 | View Replies]

To: AdmSmith

I found his disinterest till it mattered a good glimpse into Russian mir

Also the part about keeping Putin in for 5 years till new govt develops.

Good luck with that


6,346 posted on 09/15/2024 7:49:44 AM PDT by blitz128
[ Post Reply | Private Reply | To 6345 | View Replies]

To: PIF; All

“Ukraine’s western-trained ‘navy seals’ unleash wave of destruction”

“Special forces emerge from the waves to wreak havoc against the coastal defences of the Russian occupiers”

“In the black of night, four Ukrainian divers dropped over the sides of their boat, disappeared under the waves and moved towards the enemy coastline.

Trained by UK and US special forces and equipped with the best rebreathers, they swam in pairs, leaving no bubbles above them to give away their positions. The Russians never saw them coming.

Deep behind enemy lines, the divers of the 73rd Naval Special Operations Centre — the equivalent of the US Navy Seals or Britain’s Special Boat Service — have been wreaking havoc on Russian coastal defences as Ukraine tries to drive President Putin’s army from its territorial waters.”

https://www.thetimes.com/article/07186cd7-a588-4a90-a5f4-1bd68418d5bd?shareToken=3e4fde8811f6837ba2ae33888b7ee41b


6,347 posted on 09/15/2024 11:58:01 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6346 | View Replies]

To: PIF; All

“Ukrainian forces from the 3rd Assault Brigade carried out a highly effective attack on Russian positions in the Kharkiv region. Using drones to adjust fire, they successfully targeted and eliminated a group of Russian soldiers.”

https://x.com/NOELreports/status/1835346283101323624


6,348 posted on 09/15/2024 12:01:13 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6347 | View Replies]

To: BeauBo; SpeedyInTexas; blitz128; FtrPilot; PIF; Monterrosa-24; USA-FRANCE; canuck_conservative; ...

I have enjoyed reading and thinking about the several oil commentaries you have made and, Speedy also, between 6,325 and 6,331. Certainly Russia faces serious revenue challenges with deteriorating arctic infrastructure, lack of access to Western oil expertise, and inability to gain revenue from Europe exporting cheap Russian LNG. The comments that follow on the Chinese situation are also very enlightening.

I was delighted to pay $2.99/9 for travel 10 days ago in the Maryland and Virginia portions of the DelMarVa Peninsula, and not remember seeing any gas higher than $3.29/9. I have also given thought to the delightfully low gas prices last administration, which nevertheless ended with overproduction and per barrel prices so low that many producers in expensive production areas stopped pumping and drilling, leading to a very high spike in oil prices well above $100. Now you report Brent from Europe at $80 per barrel, and WTI (West Texas Intermediate) at $75, or a possible range of $65 to $80 in the future.

I would certainly hope that whichever President we have in the future, proper attention will be paid to policies and practices by both government and oil producers that will maintain livable gas prices, and adequate production levels. I will now list some bits of information I have found at a request for information on production and profits especially for hard to drill areas like shale, and fracking among others. Unfortunately, these items did not always have dates included, and prices have varied in different years past.

What oil price makes fracking profitable?
Breaking Even on Oil Production
> While consumers rejoiced at lower gas prices, oil and gas producers scrambled to stay profitable. At $120 per barrel, fracking is a very profitable business. At lower prices, companies are forced to weigh the cost of expensive fracking compared to less expensive extraction methods.

How much profit do oil companies make per barrel?
> For example, in 2021, oil prices averaged $71 a barrel, meaning oil producers could expect a profit of at least $15 a barrel, whether that oil was refined into gasoline, jet fuel or home heating oil, among other options. Apr 1, 2022

What price does oil need to be to be profitable?
> According to a 2024 survey, oil producers operating in the Permian region [Texas, mostly normal drilling] needed WTI oil prices to amount to a minimum of 62 U.S. dollars per barrel in order to profitably drill a new well. This compared to a minimum breakeven price of 38 U.S. dollars per barrel for existing wells. Apr 30, 2024 [Presumably this breakeven price refers to both standard drilling and fracking wells.]

What is the most expensive oil to produce?
> The most expensive is Canada’s oil sands at an average breakeven price of US $74 per barrel (in purple). Next to oil sands is US shale oil (in red) at US $62 breakeven – expensive to produce because of its need for multistage hydraulic fracturing.

Who has the largest oil reserves in North America?
> Oil reserves in the United States - Wikipedia
The three areas considered to hold the most oil are the coastal plain (1002) area of ANWR [Alaska], the National Petroleum Reserve of Alaska, and the Bakken Formation [N Dakota}.

Who has the most untapped oil in the world? The US
> Thanks to the shale oil boom, the US is now sitting on more oil reserves than Russia, which estimates as having 256 billion barrels of untapped oil. The next-richest countries in terms of oil after that are: Saudi Arabia (212 billion), Canada (167 billion), Iran (143 billion) and Brazil (120 billion). [Given these figures it is easy to see why Putin is cozying up to Iran and Brazil. Few realize that in 2014 when Putin invaded Ukraine, that country had just signed exploration contracts with two US oil majors. Ukraine has gas around Crimea and oil and gas in occupied eastern Ukraine. Of course, the contracts were ended in 2014.]

How much does it cost to produce one barrel of crude oil?
Crude Oil Cost
> The cost to produce a barrel varies from about $20 per barrel in Saudi Arabia’s desserts to $90 per barrel for some deep-water wells.

Thus, it is possible to consider that “drill, drill, drill” may not be the best way to maintain the moderate long range prices for gasoline and other fuels that both individuals and businesses need to make and maintain long range plans for their lives. This concept will need careful examination by all persons affected by the price of oil products.


6,349 posted on 09/15/2024 12:27:25 PM PDT by gleeaikin ( Question authority as you provide links)
[ Post Reply | Private Reply | To 6325 | View Replies]

To: SpeedyInTexas

2nd assassination attempt on DJT today. His location was never announced. Inside job?


6,350 posted on 09/15/2024 3:16:57 PM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6348 | View Replies]

To: PIF

The “nutjob” was Ryan Routh.

Left wing wacko.

But he was a supporter of Ukraine and visited Kyiv.

I’m sure RuZZian Boys on FR will play that up.


6,351 posted on 09/15/2024 4:35:18 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 6350 | View Replies]

To: gleeaikin

“What price does oil need to be to be profitable?”

It’s a range, even for similar wells, in the same area.

Each well is its own project, and costs vary according to many factors, like how deep, how far to transport, how much it produces (to dilute the fixed overhead costs) what kind of oil it has, what the financing costs are (interest on loans), etc..

Many American fracking operators can profit at $40-$50/bbl. Some fracking projects might need much higher prices to be profitable. On average, American frackers can produce cheaper than the Russian average.

Once a well has paid off the investment made to drill it and hook it up to transport, that same well can operate profitably at a lower price for its oil.


6,352 posted on 09/15/2024 8:27:35 PM PDT by BeauBo
[ Post Reply | Private Reply | To 6349 | View Replies]

Russian Offensive Campaign Assessment, September 15, 2024

Chechen Akhmat Spetsnaz Commander Apty Alaudinov aggravated Kremlin efforts to conduct prisoner of war (POW) exchanges for soldiers who defended against the Ukrainian incursion into Kursk Oblast while balancing his attempts to appeal to both the Russian Ministry of Defense (MoD) and hardline facets of Chechen society. Alaudinov responded on September 15 to requests for help from the relatives of Chechen servicemembers whom Ukrainian forces have captured in Kursk Oblast, claiming that “Chechens have always considered surrender to be the greatest disgrace.”[32] Alaudinov claimed that Chechen prisoners of war (POWs) “didn't deserve to live” and that Chechen soldiers should have attacked the Ukrainian personnel who were guarding them in order to provoke Ukrainian forces to kill them. Alaudinov claimed that he is prepared to help secure the release of other Russian prisoners of war (POWs), however. Alaudinov has been posturing himself as the spokesperson for the Russian forces operating in Kursk Oblast since the start of the Ukrainian incursion, and Russian state media has widely amplified his statements.[33] His September 15 statement denouncing Chechen soldiers who choose surrender over death is likely an attempt to rebalance his posturing to facets of Chechen society that hold similar beliefs and to portray Chechen forces as elite and making extreme sacrifices in the war. Ukraine and Russia conducted two POW exchanges on September 13 and 14, and Russia reportedly returned individuals whom Ukrainian forces captured in the Kursk direction, including many conscripts.[34] Russia has increasingly conducted POW exchanges with Ukraine since the start of Ukraine's incursion into Kursk Oblast following months of reportedly rebuffing Ukrainian overtures for POW exchanges - demonstrating the importance the Kremlin is placing on the return of Russian POWs captured in Kursk Oblast, particularly conscripts.[35] Alaudinov similarly recently berated the relatives of Russian conscripts fighting in Kursk Oblast for their complaints about their relatives’ participation in combat operations, which likely exacerbated Kremlin efforts to respond to this socially and politically sensitive issue.[36]

more + maps https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-september-15-2024

6,353 posted on 09/16/2024 1:55:46 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6320 | View Replies]

To: BeauBo

Very important “Once a well has paid off the investment made to drill it and hook it up to transport, that same well can operate profitably at a lower price for its oil.”


6,354 posted on 09/16/2024 1:57:09 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6352 | View Replies]


6,355 posted on 09/16/2024 2:13:04 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6323 | View Replies]

To: PIF; gleeaikin; SpeedyInTexas
Russian blogger

Alaudinov has provoked Kadyrov’s anger and is burying “Akhmat” Apti Alaudinov’s statement that he does not intend to rescue Chechen fighters of “Akhmat” from Ukrainian captivity has provoked the anger of a number of influential people. Among them is Ramzan Kadyrov.

According to our sources close to the Chechen leader, he was angry for several reasons. The first of them is that Alaudinov “for some unknown reason put the Chechens below other soldiers, including conscripts who did not distinguish themselves on the battlefield, but were nevertheless returned from captivity.” Which is a serious insult to an entire nation. And it is unclear why the commander of “Akhmat” would do such a thing. In relation to his own people. In addition, Kadyrov had a “secret” plan to exchange the Chechens and rescue them from captivity, into which they ended up in the Kursk region. Now this plan has been destroyed. Ramzan Akhmatovich does not know what to do. And he fears that the “Akhmatovites” who are in captivity, demoralized by such an attitude, will commit treason.

In addition, according to our information, the motivation of the “Akhmat” fighters has seriously dropped. And people from Kadyrov’s entourage say that Alaudinov “with his stupidity is burying and destroying” this unit. An interesting point. Kadyrov has decided not to punish Alaudinov for now. Ramzan Akhmatovich fears that the “Akhmat” commander “is not doing harm of his own free will, but someone important asked him to do so.” The Chechen leader does not know who these patrons in the country's leadership are, but he is finding out. After that, he plans to punish Alaudinov. And this punishment, according to sources in Grozny, “will be very harsh.” Our interlocutors note that the punishment will definitely happen. Regardless of what else Alaudinov says or does. Or of any public words of Kadyrov regarding this situation.

https://t.me/kremlin_secrets/4656

This is normal in Russia; if something happens, everyone suspects that it is due to a decision higher up and therefore you must not do anything until this has been confirmed or dismissed. It takes time and explains many things like why Prigozhine's march last summer was not stopped. "It could be on Putin's orders" Action paralysis comes in handy when the big change takes place in Russia.

6,356 posted on 09/16/2024 2:39:30 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6353 | View Replies]

To: PIF
Russian blogger:

Putin may be banned from kissing icons

The reason, according to our sources in the FSO, is banal. The rise in coronavirus cases and fears that the president will become infected. But such an initiative could entail serious negative consequences for Vladimir Putin.

Firstly, the president fears that if he stops publicly kissing icons and other holy relics, the people will not understand him. “People may think that God has abandoned Vladimir Vladimirovich. And along with him, all of Russia. Vladimir Vladimirovich cannot do this,” our source in the Kremlin explained to us.

Secondly, the proposal was made against the backdrop of wild rumors that Putin, during his visit to Mongolia, talked with local shamans about the use of nuclear weapons. “This is, of course, nonsense. But our people are suspicious. They may suspect Vladimir Vladimirovich of betraying true Orthodoxy. We do not need such suspicions,” another source close to the president noted.

Thirdly, the proposal on icons appeared against the backdrop of Patriarch Kirill’s serious illness. “Imagine that something happens to the patriarch, God forbid. And here Vladimir Vladimirovich does not kiss the icons, does not do everything that a good Christian should do. This is dangerous,” our channel's interlocutor believes.

In connection with all this, Putin has not yet decided to give up kissing icons. It is possible that this position will be revised - if COVID becomes a truly serious threat to the life and health of the president.

https://t.me/kremlin_secrets/4657

Does this also apply to the Koran?

https://freerepublic.com/focus/news/4261059/posts

6,357 posted on 09/16/2024 2:48:24 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6356 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ ATACMS Onslaught. Ukrainians Caught Huge Russian Redeployment on The Move ]


Today [ Sept 16 ], there are a lot of important updates from the Kursk direction.

Here, the Ukrainians initiated the next stage of the offensive with a powerful attack across the border, quickly approaching the town of Glushkovo. Recognizing the imminent threat of losing Glushkovo, the Russians tried to establish logistics lines using pontoon bridges and the Korenevo-Glushkovo highway. However, the Ukrainians had anticipated this move and swiftly targeted the reinforcements with ATACMS cluster warheads, effectively neutralizing the Russian efforts.

In the Glushkovo region, the situation became highly volatile and perilous for the Russian forces facing intense Ukrainian pressure. Approximately 3,000 Russian soldiers in the area have struggled to sustain logistical support for their defensive positions. The Glushkovo forces are essentially isolated from the rest of the Russian military, as crucial roads, particularly the Glushkovo-Korenevo highway, are under Ukrainian fire control.

This left only the bridges across the Seym River as the sole logistical routes for the Russian forces in Glushkovo to maintain supply lines. Combat footage from the Zvannoye area on the Seym River shows a pontoon bridge being completely destroyed by a HIMARS missile with pinpoint accuracy.

Another video from the same area depicts the destruction of Russian construction and engineering equipment on a traffic bridge at Zvannoye. Ukrainian drone operators successfully targeted and destroyed equipment, including an excavator and a truck carrying construction materials, that were attempting to repair the bridge.

Seeing how the use of bridges and pontoon crossings for maintenance of logistical flow is difficult, the Russian forces decided to launch a series of daring counterattacks, with he goal of retaking the Korenevo-Glushkovo highway in an effort to restore ground connection to Glushkovo.

By acting swiftly, the Russians achieved a tactical surprise. Leveraging newly redeployed forces from eastern Ukraine, they quickly entered Snagost and immediately intensified their operations, launching assaults on Ukrainian positions in Vishnevka, Komarovka, Vnezapne, and Krasnooktyabrske.

The Ukrainian command anticipated the Russian forces would launch an unblocking operation, so they had a predetermined course of action ready. Given that the main Russian objective was to unblock the Glushkovo forces and secure supply lines by road, the Ukrainians focused their FPV drone units on the area, targeting Russian assault units en route and transforming the road into a deadly corridor.

Russian sources confirmed that, despite the seemingly improved logistics to Glushkovo, Ukrainian FPV drones strike Russian troops on the highway every 5 minutes, consistently destroying or disrupting large portions of reinforcements, before they can arrive. A squad of Russian fighters near Vishnevka, situated close to the highway, gathered in one location, leading to their swift destruction by a Ukrainian FPV drone.

As the Ukrainian forces meticulously disrupted and destroyed Russian reinforcements along the Seym River and the main highway, they set the stage for the next phase of their offensive in Kursk. A formidable assault group was assembled, comprising tanks, armored transport vehicles, and engineering vehicles.

Combat footage from the area reveals how a Ukrainian engineering vehicle demolished Russian dragon’s teeth fortifications at the border, clearing the path for Ukrainian stormtroopers and armored columns to advance.

Upon entering Russian territory, Ukrainian assault units advanced freely across the open fields, knowing the Russians had not had time to lay landmines. They then moved along the main road to Veseloye, while Russian forces could only fire a few artillery shells, all of which fell far from their targets. Ukrainian forces soon reached the outskirts of Veseloye, which is now being stormed.

The weak Russian response to the incursion highlights a severe lack of preparedness, resulting in a breakthrough of at least 3 kilometers. With only 7 kilometers remaining to Glushkovo, Ukrainian forces are poised to strike at the Russians in Snagost.

In a desperate attempt to plug the gap and reinforce defenses, Russian troops tried to use the Seym River bridges to deploy soldiers under the cover of night. Unfortunately, Ukrainian drone operators detected over a 100 Russian soldiers near the pontoon bridge and called in a HIMARS strike.

The HIMARS missile, equipped with a cluster warhead, accurately struck multiple times, inflicting heavy casualties and forcing the survivors to trample over the bodies of their comrades in a frantic bid to save their own lives.

Overall, the rapid advancement of Ukrainian forces in the Glushkovo region has used the Russian efforts to break the encirclement of Korenevo against them by outmaneuvering Russian strike force from the Veseloye area.

This bold maneuver allowed Ukrainian forces to outflank the Russian units that had penetrated deep into Ukrainian-held territory, putting them at risk of encirclement. This development undermines the Russian objective of reestablishing logistical lines to Glushkovo and exposes significant vulnerabilities in their operational planning.

The success of the Ukrainian strategy highlights a shift in the tactical balance, potentially leading to a major setback for Russian forces, and altering the broader dynamics of the conflict in favor of Ukraine.


6,358 posted on 09/16/2024 4:10:32 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6357 | View Replies]

To: AdmSmith

Wow that is a serious problem, could change the whole outcome of the war 😎


6,359 posted on 09/16/2024 4:42:05 AM PDT by blitz128
[ Post Reply | Private Reply | To 6357 | View Replies]

To: BeauBo

Good points, I do wonder about oil transport infrastructure. As cold temperatures begin to hit the whole region the price of oil becomes less important as the constant movement of oil in pipelines.

Serious damage can happen if the oil is allowed to stagnate and becomes more solid due to temperatures.

As I understand it, the disruption of oil transport in the 90s caused major problems and took years and western help to resolve.

As has been said, one cannot simply turn a well on and off at will, not can a pipeline full of oil be allowed to stop flowing without serious consequences


6,360 posted on 09/16/2024 4:51:13 AM PDT by blitz128
[ Post Reply | Private Reply | To 6352 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 6,321-6,3406,341-6,3606,361-6,380 ... 20,981-21,000 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson